ID: 1189448345

View in Genome Browser
Species Human (GRCh38)
Location X:41102700-41102722
Sequence TTGGGTTAGCATTTCATGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189448342_1189448345 25 Left 1189448342 X:41102652-41102674 CCTTGTCTAAAATGTCATAAATG 0: 1
1: 0
2: 5
3: 45
4: 410
Right 1189448345 X:41102700-41102722 TTGGGTTAGCATTTCATGATTGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189448345 Original CRISPR TTGGGTTAGCATTTCATGAT TGG Intronic
903421309 1:23219347-23219369 TTGGTTTACCATTTGATGATTGG + Intergenic
907705017 1:56825466-56825488 TTAGGTAAGCATTTCCTGAATGG - Intergenic
908842966 1:68297106-68297128 TTAGTTAAGCATTTCATTATGGG + Intergenic
909366602 1:74830991-74831013 ATTGGTTAGCAGTTCATTATGGG + Intergenic
912348221 1:108985914-108985936 CTGTGGTAGCATTTAATGATTGG - Intronic
912765869 1:112410008-112410030 TTGGGCTAAGATTTCATGGTGGG + Intronic
917146038 1:171892838-171892860 TTGCATAAGCAGTTCATGATAGG + Intronic
917559441 1:176131902-176131924 ATGGGTTAGCAGTTCAAGAAGGG - Intronic
920914534 1:210249445-210249467 CTGGGCTAGGATCTCATGATTGG + Intergenic
921651801 1:217688556-217688578 ATGGGTGAGCATTTGAAGATGGG - Intronic
1062981778 10:1729769-1729791 TTGGGTTAGCATTTTCAGGTAGG + Intronic
1064804484 10:19115038-19115060 TTGGGTTAACAGTTCAACATAGG + Intronic
1067183698 10:44009385-44009407 TTAGGTTACCATTTCAAGACAGG - Intergenic
1067747291 10:48945415-48945437 TGGGGTTTGCATTTCTTTATAGG - Intronic
1069999699 10:72367128-72367150 TTTGGTTAGCATTTCATTCTGGG - Intergenic
1073173661 10:101535784-101535806 TTGTCTTAGCATTACATAATTGG + Intronic
1074790942 10:116887301-116887323 ATGGGTGAGGATTTCATTATGGG + Intronic
1078360837 11:10666484-10666506 CTGTGTTAGCATTTCATTTTTGG - Intronic
1080608958 11:33887454-33887476 TTGGGATAGCAGTTGATTATGGG + Intronic
1081798883 11:45843366-45843388 TTGGGTAAATATTTGATGATTGG - Intergenic
1093920710 12:24856406-24856428 GTGGGTTAGGATTTCAACATAGG - Intronic
1094800565 12:34029115-34029137 TTGGGTTGTCATTCCATTATAGG + Intronic
1095998638 12:48110971-48110993 GGTGGTTAGCATTTCAAGATAGG + Intronic
1098927591 12:76368514-76368536 GTGGGTTATCATTGCATTATGGG - Intronic
1101532232 12:105583886-105583908 CTTGGTGAGCATTTCATGTTTGG - Intergenic
1102997623 12:117362023-117362045 TTGGGATAGCATTCCTTAATGGG + Intronic
1104025162 12:125020482-125020504 TGGGGTTAGGATTTCAACATAGG + Intronic
1105902703 13:24770486-24770508 TTGGCTTAGCATTTCATAAGAGG - Intronic
1106994489 13:35465529-35465551 CTGGGATATCATTTAATGATCGG - Intronic
1107791022 13:44002335-44002357 TTGGGTTGGCCTTTCAGGATTGG + Intergenic
1108278627 13:48838674-48838696 TTGGGTAAGGATTTTATGTTGGG + Intergenic
1108619035 13:52163076-52163098 TTGGTTCTCCATTTCATGATAGG + Intergenic
1109412260 13:61986216-61986238 ATGTATTAGCATTTCATGTTTGG + Intergenic
1109796749 13:67324759-67324781 TTGGGTTGTCATTTTATTATGGG + Intergenic
1111908815 13:94287242-94287264 TTTGGTTAGTGTTTCATGAAAGG - Intronic
1112679375 13:101744816-101744838 TTCGGTTAGCATTTATTGAGTGG + Intronic
1112862016 13:103842276-103842298 TTTGTTTAGTAATTCATGATGGG + Intergenic
1113652542 13:112045894-112045916 TTGGGTTAACAACTCATGGTTGG + Intergenic
1116751267 14:48888665-48888687 TTGAATTAGCAGTTAATGATTGG - Intergenic
1117453852 14:55878360-55878382 TTAGTTTAGTATTTTATGATTGG + Intergenic
1118107458 14:62676204-62676226 TTGGTTAAGCATTTCATGTATGG - Intergenic
1119603565 14:75994958-75994980 TTGGATGAGCATTTCTTGCTGGG + Intronic
1124005652 15:25793640-25793662 TTTGGTTAGCATAGCATGCTTGG + Intronic
1124853492 15:33363668-33363690 TTATGTTAACATCTCATGATTGG - Intronic
1126977041 15:54195030-54195052 TTGGGTTAGCTTTTCAGGATCGG + Intronic
1130804471 15:87304385-87304407 TTGGGTAACAATTTCATGAAAGG - Intergenic
1140248644 16:73274334-73274356 TTTGGTCAGCATTTCTTTATTGG + Intergenic
1140784024 16:78322977-78322999 TTGGGTTAGGTTTGGATGATGGG + Intronic
1144545818 17:16194233-16194255 TTGTCTTTGCTTTTCATGATAGG - Intronic
1145102817 17:20090831-20090853 TTGGGTCTGCATTTCATATTTGG + Intronic
1146945794 17:36872596-36872618 TTGGGTTAGGATTTCAACATAGG - Intergenic
1147520049 17:41162344-41162366 TTGGGTTAGCAATTTCTGTTTGG + Intergenic
1148349692 17:46931587-46931609 TTAGATCAGCATTTCATTATGGG - Intronic
1156500698 18:37555475-37555497 TTGGGAGAGCTTTTCATGGTGGG - Intronic
1157493786 18:48141201-48141223 TTGGGGGAGCATTTCAGGCTGGG - Intronic
1157968715 18:52240431-52240453 TTCAGTTAGCATTTCATAAGGGG + Intergenic
1159134761 18:64324240-64324262 TTGGCCTAGCAATTTATGATGGG + Intergenic
1160222521 18:76987794-76987816 TTTGGTTAGAATATAATGATTGG + Intronic
1161347846 19:3776989-3777011 ATGGGTGAGATTTTCATGATTGG + Intergenic
1168136550 19:54355868-54355890 TTGGGTTAGGAATTCAGGAGTGG - Intronic
925605756 2:5658261-5658283 TTGGGGTAGGATTCAATGATAGG - Intergenic
930723065 2:54656557-54656579 TAGGAATAGCATTTCATAATTGG + Intronic
931996655 2:67845243-67845265 TTAGGTTAGTATTTTTTGATGGG - Intergenic
940637252 2:156313239-156313261 TTGGGTGAGCAATACATAATTGG + Intergenic
940698506 2:157011518-157011540 TTTGTTAAGTATTTCATGATAGG + Intergenic
941543203 2:166812889-166812911 TTAGGTTAGCATGATATGATAGG - Intergenic
943122042 2:183748768-183748790 GGGGGTTAGGATTTCATGATAGG - Intergenic
946927802 2:224643119-224643141 TTGGCTGAGCATTTGTTGATGGG + Intergenic
1172533011 20:35646835-35646857 ATGGCTTGCCATTTCATGATAGG - Intronic
1175415881 20:58800647-58800669 TTGGGTCAGGATTTCCAGATGGG + Intergenic
1175542821 20:59758676-59758698 TTGTGCCAGCATTTCATCATGGG - Intronic
1181384428 22:22533496-22533518 AGGGGTTAGCATTTCAACATAGG - Intergenic
1184528115 22:45037436-45037458 TGGTGTCAGCATTTCATGAGAGG + Intergenic
949315983 3:2756232-2756254 TGGGGTTAGGATTTCAACATAGG - Intronic
949696082 3:6697604-6697626 GTGGCTTTGCTTTTCATGATAGG - Intergenic
949771184 3:7579909-7579931 TTTGGTTAGCATTTCAGCATAGG + Intronic
951118976 3:18901123-18901145 GTGGGTCAGCAGTTCATGCTTGG + Intergenic
951336534 3:21429554-21429576 TTGGGATAGCTTTTCATAAGTGG + Intronic
952185661 3:30965624-30965646 ATGGGTTTGCATTTCATCCTGGG + Intergenic
955638973 3:61061435-61061457 TAGGGTTAGCAATTTATGAAAGG - Intronic
959550911 3:107656144-107656166 GTGGTTTAACATTTCATAATTGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
959994911 3:112669907-112669929 TTGTGTTTGCTTTTCCTGATGGG + Intergenic
962220551 3:133561160-133561182 TTTTGTTTGCATTTCATGATTGG - Intergenic
963793614 3:149609269-149609291 TTGGGTTAGCTAATCATAATCGG + Intronic
963809369 3:149759804-149759826 TTGGGTTATCTTTTAATTATTGG - Intergenic
964080942 3:152755961-152755983 TGGGGTTAGGATGACATGATTGG + Intergenic
966197684 3:177329775-177329797 TTGGGTTAGCATTTGGAGAGGGG - Intergenic
968471050 4:782459-782481 TAGGGTTACTATTTCATGAGTGG - Intergenic
973758159 4:54094992-54095014 TTGGCTTAGAATTTCAGGAACGG - Intronic
975421883 4:74174229-74174251 TGGGGTTAGGATTTCAACATAGG + Intronic
975987512 4:80215320-80215342 TTGGGTTTGCTATTCATTATTGG - Intergenic
977901292 4:102425280-102425302 TGGGGTTAGGATTTCAACATAGG - Intronic
981555345 4:145987531-145987553 TTGGTTTAGGATTTCAGAATAGG + Intergenic
981887445 4:149693591-149693613 ATGGGTTAGAGTTTCATGGTTGG - Intergenic
986319550 5:6617553-6617575 TTCGGTTGGCTTTTTATGATGGG - Intronic
993972764 5:94440680-94440702 TTGGGTAATCATTTCATCAAAGG + Intronic
994495015 5:100500625-100500647 TTGAGTTAACATTTCCTGTTGGG + Intergenic
995927954 5:117398360-117398382 TGTGCTTAACATTTCATGATTGG + Intergenic
998551023 5:143078153-143078175 TTGAGTTAGCGTAACATGATTGG - Intronic
1001744220 5:174078607-174078629 GGGGGTTAGCATTTCAACATCGG - Intronic
1006219467 6:32476302-32476324 TTGGGTTAGCTTTTCCTCGTAGG + Intergenic
1007344871 6:41222044-41222066 AGGGGTTAGCATTCCATGCTGGG + Intergenic
1011307922 6:85949494-85949516 TTGGGGCAGAATTTCATAATTGG - Intergenic
1011351213 6:86425954-86425976 TTGGGTTGGCATTTCATCTCTGG - Intergenic
1013831474 6:114277939-114277961 TAGGGTGACCATTTCATGTTTGG - Intronic
1015238818 6:131000890-131000912 TTGGGAATTCATTTCATGATTGG - Intronic
1015919310 6:138250790-138250812 TTCTGTGAGCATTTCATGGTTGG - Intronic
1018262535 6:161984780-161984802 TGCTGTTAGCATTTCATGAAGGG + Intronic
1026612296 7:71870833-71870855 TTGGGTTGGCCTTGCATGGTTGG + Intronic
1026720001 7:72822694-72822716 TTGGGCTAGGATTACAGGATAGG - Intronic
1030521889 7:110607528-110607550 TTGCCTTACCATTTCATGTTTGG + Intergenic
1030709043 7:112728321-112728343 TTTGTTTAGTATTTCATGTTAGG + Intergenic
1031437105 7:121745970-121745992 TTGGTTGAGCATTTCAGTATTGG - Intergenic
1031441152 7:121796059-121796081 TTGGGATAGAAATTCATGAGGGG - Intergenic
1031488814 7:122363112-122363134 TTGAGTTAGCCAGTCATGATTGG - Intronic
1034744977 7:153516122-153516144 ATATGTTAGCATTTCATGATGGG - Intergenic
1035561117 8:604178-604200 TGGGGATAGAATTTCATGGTCGG + Intergenic
1036769500 8:11569037-11569059 TTGGGTTAGGGTTTCAATATAGG + Intergenic
1037259592 8:16992991-16993013 TTGGGTCATTATTTTATGATGGG + Exonic
1037830684 8:22186925-22186947 TTGGGTTCTCACTACATGATAGG - Intronic
1039722029 8:40174490-40174512 TTGGGTCAGCATTGCTTCATGGG - Intergenic
1040666520 8:49640380-49640402 TTGAATCAGCATATCATGATGGG - Intergenic
1043465426 8:80501639-80501661 TTGGGTTAGCTTTCAGTGATAGG + Intronic
1045714091 8:105021296-105021318 TGGGATTAATATTTCATGATCGG + Intronic
1047189138 8:122662012-122662034 TGGGGATAGCATTTCAATATGGG - Intergenic
1048696503 8:137034492-137034514 TGGGGTTAGGATTTCAACATAGG - Intergenic
1053334934 9:37259089-37259111 TTGGGTTAGCGTCTAATGGTCGG + Intronic
1061075089 9:128336314-128336336 TTGTGTTACCAGCTCATGATTGG + Intergenic
1061382141 9:130265163-130265185 TAGGGTTAGTATTTCATTCTAGG + Intergenic
1061590651 9:131595465-131595487 TTGGGCTAGGATTTCAAGGTGGG + Intronic
1185881571 X:3745824-3745846 GGGGGTTAGCATTTCAACATAGG + Intergenic
1187204634 X:17170448-17170470 TTGCTCTAGCATTTCAAGATTGG + Intergenic
1187795106 X:22994880-22994902 TGGGGTTAGGATTTCAACATAGG + Intergenic
1189204891 X:39229490-39229512 TTGGGTTTGCATTGCAAAATGGG - Intergenic
1189448345 X:41102700-41102722 TTGGGTTAGCATTTCATGATTGG + Intronic
1192365456 X:70468980-70469002 TTGGGTTAGTTTCTAATGATGGG - Intronic
1197599620 X:128512880-128512902 TTGGATTAGGATTTCATGAGAGG - Intergenic
1198789645 X:140330251-140330273 TTGGGTTGTCTTTTCATTATTGG + Intergenic