ID: 1189449419

View in Genome Browser
Species Human (GRCh38)
Location X:41114189-41114211
Sequence TAAACCTTGAATAACATTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 2, 2: 23, 3: 104, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189449419 Original CRISPR TAAACCTTGAATAACATTAC GGG Intronic
900904750 1:5547707-5547729 TAAACCTTGAATAACACTATGGG + Intergenic
902471990 1:16654857-16654879 TAAAACTTGAGTAAAATTACAGG - Intergenic
902486813 1:16752589-16752611 TAAAACTTGAGTAAAATTACAGG + Intronic
903094931 1:20962631-20962653 TAAACCTTGAATAACACCATGGG - Intronic
904152441 1:28453302-28453324 TAAATCTTGAATAACACCACGGG + Intronic
906913269 1:49979762-49979784 TAAACTTTGAATAACAACACAGG + Intronic
907327474 1:53649519-53649541 TAAACTTTGAATAACACCATAGG + Intronic
908379436 1:63582205-63582227 TAAACCTTGTCTAACACTATGGG + Intronic
908676196 1:66606843-66606865 TAATCCGTGTATAACATTCCTGG - Intronic
909349100 1:74628247-74628269 TAAACACTGAATAACATCATGGG + Intronic
909564929 1:77043669-77043691 TAAACCTTGATTAAAATTCTTGG - Intronic
909831515 1:80197370-80197392 TAAACTTTGAATAACACCAGGGG + Intergenic
910436949 1:87215067-87215089 TAGACCTAAAATAAAATTACCGG - Intergenic
911590607 1:99743874-99743896 TAAACCTTGAATAACACCATGGG + Intronic
912032021 1:105260069-105260091 TAAACCTTGAGTAACACCATGGG - Intergenic
912327209 1:108778337-108778359 TAAACAGTGAATAACAGTGCTGG - Intronic
912841060 1:113039507-113039529 TAAACCTTGAATAACACCTTGGG + Intergenic
912961336 1:114198188-114198210 TCAACCTTGAATCCCTTTACTGG + Intergenic
913136866 1:115899250-115899272 TAAACCTTGAATAACACCATGGG - Intergenic
913153594 1:116071020-116071042 TAAACCTGGAATAATACTTCTGG + Intergenic
914219881 1:145670768-145670790 GAAACCGTGAATAACTTAACTGG + Intergenic
914472461 1:147993638-147993660 GAAACCGTGAATAACTTAACTGG + Intergenic
915942415 1:160127085-160127107 TAACCCTTGTGTGACATTACAGG - Intronic
917824446 1:178802437-178802459 TAAACCTTGAATAACACCATGGG - Intronic
917984495 1:180301678-180301700 TAAACCTTGAATAACACAAGGGG - Intronic
918082680 1:181219686-181219708 TAAAACTTTAAAAACATTACAGG - Intergenic
918129605 1:181614396-181614418 TAAACCTTGAATAACATCATGGG - Intronic
918601140 1:186364187-186364209 TAAACCTTGAATAACAACATGGG + Intronic
918766280 1:188488348-188488370 TAAACTTTGAATAACACCATGGG + Intergenic
919029373 1:192220792-192220814 TCAACCTTGAATAACACCATAGG + Intergenic
919325154 1:196098335-196098357 TAAAACTTGAAAAACATTATGGG - Intergenic
921732112 1:218590262-218590284 TAGACATAGAATAATATTACAGG - Intergenic
922117115 1:222624561-222624583 TAAACCTTGAATAACACTCTGGG + Intronic
922120382 1:222661168-222661190 TAAACCTTGAATAACACCATGGG + Intronic
924377528 1:243429010-243429032 TAAACCTTGAATAACACCGTGGG + Intronic
924495005 1:244579015-244579037 TAAACCTTGAATAACACCATGGG - Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1064658934 10:17586228-17586250 TAAACCTTTAGCAAAATTACTGG - Intergenic
1065059017 10:21878166-21878188 TAAACCTTGAATAACACCATTGG - Intronic
1066340870 10:34531805-34531827 TAAACCTTGAATAACGCCAAGGG - Intronic
1066668418 10:37811045-37811067 TAAACACTGAATAACACTATTGG + Intronic
1068003223 10:51361301-51361323 TAAACCTTGTTTAACAGTATAGG + Intronic
1068298294 10:55104804-55104826 TAAACCTTAAATAACACCATGGG - Intronic
1068761091 10:60710088-60710110 TAAACCTTGAGTAACACTGTGGG - Intronic
1069193824 10:65524057-65524079 TAAACCATCAAAAACATTACAGG + Intergenic
1069732785 10:70629970-70629992 TAAATCTTGAATAACACCAGGGG + Intergenic
1071174082 10:82903401-82903423 TAAACCTTGCATAACACCATGGG + Intronic
1071816406 10:89236476-89236498 TAAACCTTGAATAACACCATTGG + Intronic
1072266949 10:93739771-93739793 TCAACCTTGAATAACACCATAGG - Intergenic
1072478773 10:95789999-95790021 TAAACTTTGAATAACAACATGGG + Intronic
1072643935 10:97236933-97236955 AACATGTTGAATAACATTACAGG + Intronic
1072879097 10:99205959-99205981 CAAACCTTGACTAACATCATGGG + Intronic
1073920977 10:108458527-108458549 TAAACCTTGACTAACACCATAGG - Intergenic
1074804989 10:117040006-117040028 TAAAAATTGTAAAACATTACTGG + Intronic
1075218365 10:120560139-120560161 TAAACCTTGAATAACACCATGGG + Intronic
1075286267 10:121189243-121189265 GAAACTTTGGATAACATTCCCGG + Intergenic
1076718442 10:132380716-132380738 TAAACCTTGAAGAACACTTTGGG + Intergenic
1078562172 11:12381936-12381958 TAAACCTTGACTAACACCATGGG - Intronic
1080103823 11:28490723-28490745 CAAACATTGAAGAAAATTACAGG + Intergenic
1080221074 11:29905141-29905163 TAAACTTTGAATAACACCATGGG + Intergenic
1081949874 11:47035333-47035355 TAAACCTCAAATAACACTATCGG - Intronic
1082930446 11:58597922-58597944 GAAACCTTGACTAACACTACGGG - Intronic
1083037529 11:59653699-59653721 TAAACGTAGAAAAACATTTCAGG - Intronic
1083516084 11:63260725-63260747 AGAACCTTGAAAAAGATTACTGG - Intronic
1085489599 11:76902652-76902674 TAAACTTTGAATAACACCACAGG - Intronic
1085991778 11:81856846-81856868 CAAACCTTGAATAACACCATGGG + Intergenic
1086285133 11:85239018-85239040 TAAATCTTGAATAACACCATGGG - Intronic
1086722660 11:90140001-90140023 TAAACCTTGAATAACACCGTGGG - Intronic
1087172444 11:95063866-95063888 TAAAGCTTGAATAATACTATGGG + Intergenic
1087325581 11:96719344-96719366 TAAACCTTAAATAACACCATAGG + Intergenic
1090108611 11:123879226-123879248 TAAATCTTGAATAACACCATGGG - Intergenic
1091190478 11:133690629-133690651 TACACGTTCAATAACATTTCAGG + Intergenic
1091660636 12:2380784-2380806 AAAGCCTTAAATAACATGACTGG + Intronic
1091855412 12:3735577-3735599 TAATCCTTGAACTACCTTACAGG - Intronic
1092313788 12:7388403-7388425 TAAAACTTGAATAACTCGACAGG + Intronic
1093258134 12:16898306-16898328 TACACCTTGAATAACACCATAGG + Intergenic
1094377527 12:29806333-29806355 TAAACTTTGAATAACACCATGGG - Intergenic
1095549217 12:43413387-43413409 TACACCTTGAAAAAAGTTACAGG + Intronic
1096591314 12:52661253-52661275 TAAACCTTGAATAACACCATGGG - Intergenic
1097391736 12:59023527-59023549 TAACACTTGAAAAACAGTACAGG - Intergenic
1097452043 12:59748546-59748568 TAAACCTTGAATAACACCACGGG + Intronic
1098266715 12:68729016-68729038 TAAACCCTTAATAACACCACAGG - Intronic
1098746025 12:74237977-74237999 TAAACCATGAATAACACCATGGG + Intergenic
1098869356 12:75799632-75799654 TAAACCTTGAATAATACCATGGG - Intergenic
1098934066 12:76457018-76457040 TAAACCTTGAATAACGCTATGGG - Intronic
1099418060 12:82418608-82418630 TAAACCTTGAATAACATCATGGG + Intronic
1099730820 12:86498838-86498860 TAAACATCGAATAACATCATGGG + Intronic
1101472096 12:105007484-105007506 TAAACCTTGAATAACACCATAGG - Intronic
1102411470 12:112723593-112723615 TAAACCTTGAATAACTCCATGGG - Intronic
1103489596 12:121306674-121306696 TAAACATTGAATAATATTAAAGG - Intergenic
1104372106 12:128232527-128232549 TAAACCATGAATAAGAATTCTGG + Intergenic
1105612338 13:21979486-21979508 TAAACCTTGAATAACACCGTAGG - Intergenic
1106785038 13:33098686-33098708 TAAACCTTGACTAACACCAGGGG - Intergenic
1107136195 13:36946404-36946426 TAAACCTTGAATAACACCATGGG - Intergenic
1107350624 13:39510828-39510850 TAAACCTGAAATTAAATTACTGG + Intronic
1108068631 13:46604630-46604652 TAAACCTTGTAGAACATCAGAGG - Intronic
1108839974 13:54601029-54601051 AAAAACTTGAATAACAACACAGG - Intergenic
1109089299 13:58019146-58019168 AAAACCCTGAATAACACTATAGG + Intergenic
1109464712 13:62715123-62715145 TAAACTTTGAATAACACCATGGG + Intergenic
1109521510 13:63517532-63517554 TAAACCTTGAATAACAGCATGGG - Intergenic
1110155544 13:72312414-72312436 TAAATGTTCAATAATATTACAGG - Intergenic
1110197039 13:72801791-72801813 TAAGCCTTGAATAACACCATGGG + Intronic
1110306693 13:73996124-73996146 TAAAACTGGAATAAAATTAAAGG - Intronic
1111495695 13:89046504-89046526 TAAATCTTAAATAACATTATGGG - Intergenic
1112096669 13:96140466-96140488 TAAACCTTGACTAACACCATGGG + Intronic
1112301801 13:98237639-98237661 TAAACTTTGAATGACACTATGGG + Intronic
1112927478 13:104694340-104694362 AAAACCTGGAATAACACAACAGG - Intergenic
1112994697 13:105559222-105559244 TAACCCTTGAATAACATAGGTGG - Intergenic
1113844217 13:113376737-113376759 TACACCTGGAATAGCGTTACTGG + Intergenic
1114152679 14:20063008-20063030 TAAAACTTGAATTCCATTCCAGG + Intergenic
1114661405 14:24347523-24347545 TAAACTTAGAATGACATGACAGG - Intergenic
1115153913 14:30316378-30316400 TAAACCTTGAATAACACCATGGG - Intergenic
1115283152 14:31687735-31687757 TGAACCTTGAATAACACCATGGG + Intronic
1115796388 14:36941993-36942015 TAAACCTAAAATAACAAAACTGG + Intronic
1116129556 14:40837576-40837598 TAAACCTTGAGTAACACTCTGGG + Intergenic
1117365532 14:55023574-55023596 TAAACTTTGAATAACACCATGGG - Intronic
1117981334 14:61344826-61344848 TAAAGCTTGAAGAACCTTAAAGG + Intronic
1118013903 14:61639387-61639409 TAAACCTTGAATAACACCATGGG + Intronic
1118937850 14:70304008-70304030 TAGACCTAGAATAAAATGACTGG + Intergenic
1119019131 14:71092002-71092024 TAAACCTTAAATAACACCATGGG + Intronic
1120125937 14:80743526-80743548 TAAACTTTCAATAATATTATGGG + Intronic
1120150296 14:81024856-81024878 TAAACCTTGAATAACACCATGGG - Intronic
1120791195 14:88584760-88584782 TAAACCTTGAATAACACCAGGGG + Intronic
1121148652 14:91609271-91609293 TAAACCTTAAATAACACCATGGG - Intronic
1121190274 14:92021506-92021528 AAAACTTTGAGTAAAATTACTGG - Intronic
1121763055 14:96461932-96461954 TAAGCCTTGGATAAGATTTCTGG - Intronic
1121905907 14:97744021-97744043 TAAACCTTGAATAACACGACGGG - Intergenic
1124869480 15:33526515-33526537 TAATTCTGGAATAACATTCCAGG - Intronic
1125311508 15:38384186-38384208 TAAACTTTGAATAACACCATGGG + Intergenic
1125814454 15:42572896-42572918 TAAGCCTTGAATAACATCAGGGG + Intergenic
1127101852 15:55574094-55574116 TAAACCTTAAATAACACCATGGG - Intronic
1127793843 15:62421812-62421834 TAAAAGTTAAATAAAATTACAGG + Intronic
1128305509 15:66596197-66596219 TAAACCTTGAATCACATAATGGG + Intronic
1129019144 15:72499265-72499287 TATACATTAAATACCATTACTGG - Intronic
1133748878 16:8708898-8708920 TAAACCTTAAATAACAATACTGG - Intronic
1135349955 16:21720462-21720484 TAATCCTTCAAGATCATTACAGG + Intronic
1136035399 16:27535913-27535935 TAAACCTTGACTAACACCATGGG + Intronic
1136387112 16:29935393-29935415 TAAGCCTTGTATAACACCACGGG - Intergenic
1136488610 16:30589818-30589840 TAAACCTTAAATAACACCATAGG + Intergenic
1141073743 16:80982857-80982879 TAAAACTTGAATAACACCATGGG + Intronic
1141883818 16:86878484-86878506 TTAACCTTTAAAAACAATACCGG + Intergenic
1144363518 17:14519717-14519739 CACACCTTGTATAACATTCCAGG - Intergenic
1144365403 17:14539817-14539839 TTAACCTTGAATAACACCACAGG + Intergenic
1145115091 17:20202375-20202397 CAAACCTTGAATAACACTATGGG + Intronic
1147126420 17:38372630-38372652 TAAACCTTGAGTAATACTATGGG + Intronic
1148140789 17:45326630-45326652 TAATCCTTGACTGACATTTCCGG - Intergenic
1149925931 17:60702386-60702408 TAAACCTTGAATACCACGATGGG + Intronic
1150902384 17:69295339-69295361 TAAGCCTTGAATAGCATCATGGG - Intronic
1151238675 17:72740618-72740640 TAAACCTTGAATAACAGCACGGG - Intronic
1151531392 17:74707779-74707801 TAAACCATGAATAAGATAAAAGG + Intronic
1152774255 17:82190288-82190310 TAAACCTTCAATAACACCATGGG + Intronic
1153263327 18:3245199-3245221 AAATCCTTGAAAAACATTATAGG + Intergenic
1153409200 18:4774908-4774930 TAAACTTGGAATAATATCACAGG + Intergenic
1155104189 18:22644793-22644815 TAAACCTTGAATAATACCATGGG + Intergenic
1155557485 18:27036435-27036457 GTAACCTAGAATTACATTACAGG + Intronic
1155758892 18:29539537-29539559 AAAACCTTGAATAACACCATGGG + Intergenic
1156719000 18:40046953-40046975 TAAAGCTTGAACATCATTCCTGG - Intergenic
1157045930 18:44101762-44101784 TAAACCTTGAATAACACCATAGG + Intergenic
1157382288 18:47229736-47229758 GAAAGCTTGAAAAACACTACTGG + Intronic
1158017630 18:52803180-52803202 TAAACCTTGAATAACACCATGGG - Intronic
1158731200 18:60024593-60024615 TAAACCTTGAATAACATCATGGG + Intergenic
1159066898 18:63579990-63580012 TACAGCTTGAATAACATCATGGG + Intergenic
1159502487 18:69291815-69291837 TAAACTTTGAATAACACCATGGG - Intergenic
1159711030 18:71760694-71760716 TAAACCTTGAATAACATCTTGGG - Intronic
1160476118 18:79189864-79189886 TGAACCTTGAATAATACCACGGG - Intronic
1162387571 19:10369118-10369140 TAAACCTTGATTAAGATTTGGGG + Intronic
1163787644 19:19284118-19284140 TAAACCTTGAATAACATCATGGG + Intronic
1163995906 19:21047230-21047252 AGAACCATGAAAAACATTACAGG - Intronic
1164067665 19:21734308-21734330 GGAACCATGAAAAACATTACAGG + Intronic
1164082335 19:21869587-21869609 AAAACCTTACATAACAGTACTGG - Intergenic
1164189928 19:22904937-22904959 GAAACCTTACATAACAGTACTGG - Intergenic
1164893659 19:31848176-31848198 TAAACCTTGAATAACACTCTGGG - Intergenic
1165877394 19:39018498-39018520 TAAACCCTGAATAACACCACGGG + Intronic
1167837800 19:52088817-52088839 TAAACTCTGAATAACAACACAGG + Intronic
1202704389 1_KI270713v1_random:11651-11673 TAAAACTTGAGTAAAATTACAGG - Intergenic
925102894 2:1264446-1264468 TAAACCTTGAATAACACCCCGGG + Intronic
925463523 2:4085965-4085987 TAAACCTTCAAAAACATAAAGGG + Intergenic
926361626 2:12093392-12093414 TACACCTTAAATAACAATAATGG - Intergenic
926770633 2:16371167-16371189 TATACCTTTAATTACATTAAAGG + Intergenic
927244534 2:20946570-20946592 TAAACCTTGAATAACACCATGGG - Intergenic
928274185 2:29884279-29884301 TAAACCTTTAATAACACCATGGG + Intronic
930280774 2:49367266-49367288 TAAACAATGAATGACATTCCTGG - Intergenic
930343996 2:50155122-50155144 AAAAACTTGAATCGCATTACTGG - Intronic
931225887 2:60331436-60331458 TAAACCTCGAATAACACCATGGG + Intergenic
931366069 2:61620083-61620105 TTCACCTTGAATAACAATCCAGG - Intergenic
932318923 2:70806306-70806328 TAAACCTTGAATAACATCATGGG + Intergenic
932384113 2:71314975-71314997 TAAACCCTGAATAACACCATGGG - Intronic
932690944 2:73913231-73913253 TATTCCTTGAAACACATTACTGG - Intronic
932990717 2:76782415-76782437 TAAACCTTAAATAACATCATGGG - Intronic
933485470 2:82916642-82916664 TAAATCTTGAATAATATTACGGG - Intergenic
933918849 2:87024331-87024353 TAAACCTTGAATAACACCATGGG - Intergenic
934004145 2:87745585-87745607 TAAACCTTGAATAACACCATGGG + Intergenic
935153053 2:100456470-100456492 TAGACCTAGAATAAAATGACTGG + Intergenic
935391261 2:102555152-102555174 TAAACCTTTAATAACACCATGGG - Intergenic
935473510 2:103489069-103489091 TAAACCTTAAATAAAATCATGGG + Intergenic
935767101 2:106379597-106379619 TAAACCTTGAATAACACCATGGG + Intergenic
935911875 2:107905601-107905623 TAAACCTTGAATAACACCATGGG + Intergenic
937088461 2:119188051-119188073 TAAACCTTGAATAGCATCATGGG - Intergenic
937391448 2:121491122-121491144 TATAACTTGAAAAATATTACAGG - Intronic
938556947 2:132433498-132433520 TAAACCTTGACTAACATCATGGG + Intronic
939084636 2:137704633-137704655 TAAACCTTGAATAACACCACAGG + Intergenic
939280311 2:140055555-140055577 TAAACCTTGAATAACACCAGGGG - Intergenic
939712420 2:145539377-145539399 AAAACCTTGGATTGCATTACAGG + Intergenic
940952487 2:159691704-159691726 TAAACCTTGAGTAACACTATAGG - Intergenic
941963712 2:171279642-171279664 TGAACCTTGAATAACATCATGGG + Intergenic
942245849 2:174007314-174007336 TAAACTTTGAATAACACCATGGG + Intergenic
942264006 2:174202514-174202536 TAAACCTTGAATAACACCATGGG + Intronic
943239889 2:185369115-185369137 TAAACCTCGAATAACACCATAGG - Intergenic
944410538 2:199437809-199437831 TAGGCCTTGAAAAAAATTACTGG - Intronic
944624099 2:201552305-201552327 TAAACCTTGAATAACACCATGGG + Intronic
945491832 2:210465289-210465311 TAAACCTTGAATAACACCATGGG + Intronic
945630833 2:212274321-212274343 TAAACCTTGAATAACACCATGGG - Intronic
945671805 2:212811082-212811104 TACATTTTGAATAAAATTACAGG - Intergenic
946443865 2:219721011-219721033 TAAACTTTGAATAACACCATGGG - Intergenic
946711080 2:222506285-222506307 TAAACTTTGAATAACACTGTGGG + Intronic
947206385 2:227665058-227665080 TAAGCCTTGATTCAGATTACAGG - Intergenic
947896617 2:233680215-233680237 TAAACCTTGAATACCACCATGGG - Intronic
948042419 2:234913350-234913372 TAAACCTTGAATAACACCATGGG - Intergenic
948421894 2:237865012-237865034 AAAACCTTGAAGGACATTAAAGG + Intronic
1168807057 20:677769-677791 TAAACATTGAAAAACATTGCAGG + Intergenic
1170684309 20:18555320-18555342 AACAAGTTGAATAACATTACTGG + Intronic
1170977466 20:21180073-21180095 ACAAACTTGAATAACAGTACTGG - Intronic
1173096020 20:40029368-40029390 TAGACATTGAATAAGAATACAGG + Intergenic
1173675348 20:44829827-44829849 TAAACCTTGAATGACATCATGGG - Intergenic
1177063811 21:16404085-16404107 TAAACCTTGAATAACAGCATGGG - Intergenic
1178153315 21:29821447-29821469 TAAACCTTTAATAACAGCATGGG - Intronic
1178869022 21:36355951-36355973 TAAACCTTGAAAAACACCACAGG - Intronic
1179016621 21:37599450-37599472 TAAACATTGAATAACATCATGGG + Intergenic
1179122332 21:38559563-38559585 TCAACCTTAAATAACAGTAGAGG + Intronic
1182845065 22:33423727-33423749 TAATCCTTGAATTTCATTCCAGG + Intronic
1184363786 22:44035724-44035746 TAAACCCTGAATAACACTATGGG - Intronic
949394384 3:3599261-3599283 TAAGCCTTGAATAACACAATGGG - Intergenic
950385247 3:12653802-12653824 TAAACTTTGAATAACAGCATGGG + Intronic
951001412 3:17564254-17564276 TAAAAGTTGAAAAACTTTACAGG + Intronic
951117626 3:18883854-18883876 TAACCCTTTAATAACACTATGGG + Intergenic
951119359 3:18906902-18906924 TAAAACTTGAGTAAAATTACAGG + Intergenic
951510605 3:23497261-23497283 TAAACCTTAAATAACACCATGGG - Intronic
953203883 3:40803455-40803477 TAAACCTTGAATAACATCATGGG + Intergenic
953379739 3:42460105-42460127 TAAACTTTGAATAACACCATGGG - Intergenic
953778923 3:45848426-45848448 TAAGCCTTAAATAACATCATGGG - Intronic
954141943 3:48611973-48611995 TTAACATTGAAATACATTACAGG + Intergenic
956064491 3:65382982-65383004 TAAATTTAGAATAACATAACAGG - Intronic
956150764 3:66240025-66240047 CAAACTTTGAATAACACCACAGG - Intronic
956361883 3:68456954-68456976 TAAACCTTGGATAACACCATGGG - Intronic
956572312 3:70710750-70710772 TAAACCTTGAATAACACCATGGG - Intergenic
957827147 3:85462422-85462444 TAAACTTTCAATAACATTTGTGG - Intronic
958269411 3:91480424-91480446 TAAACCTTGAATAACACCGTGGG - Intergenic
958599689 3:96279322-96279344 TTCCCATTGAATAACATTACTGG + Intergenic
958861352 3:99448533-99448555 AAAACCTTGAAAAACATTGGTGG - Intergenic
959468111 3:106715310-106715332 TAAACCTTGAATAATACCATGGG - Intergenic
959600940 3:108184882-108184904 TAAACCCTGAATAACACCATGGG + Intronic
959837252 3:110934086-110934108 TAAAACTTGAGTAACACTATGGG - Intergenic
959922257 3:111881353-111881375 TAAACCCTGAATAACACCATGGG - Intronic
959969067 3:112388411-112388433 TAAACCTTCAATAACACCATGGG + Intergenic
960023372 3:112980888-112980910 TAAAATTTGAATAAAATTTCAGG - Intergenic
960799895 3:121527784-121527806 TAAACCTTGAATAATACCATGGG - Intronic
962545229 3:136427477-136427499 TAAACCTTGAATAACATTATGGG + Intronic
962783842 3:138747285-138747307 CAAACCTTGAATAACACTGTGGG - Intronic
963361464 3:144278422-144278444 TAAACCTTTAATAACATCACAGG + Intergenic
964033808 3:152171120-152171142 TAAACCTAGAATAACACTATGGG + Intergenic
964297460 3:155249724-155249746 CAAACCTTGAATAACACCATGGG - Intergenic
964736077 3:159919315-159919337 TATACCTAAAATAAAATTACTGG - Intergenic
964791489 3:160457146-160457168 TGAACCTTGAATAACACCATGGG + Intronic
966456689 3:180125719-180125741 TAAACCTTGAATAACATCATGGG + Intergenic
967566130 3:190975322-190975344 TAAAACTTGAATAACATCATGGG + Intergenic
968034338 3:195533484-195533506 TAAACCTTGAGTAACACCATGGG + Intronic
970156457 4:13146657-13146679 TAAACCTTGAAAAACACCACAGG + Intergenic
970265807 4:14284104-14284126 TAAACCAAGAATGATATTACTGG + Intergenic
970422385 4:15917601-15917623 TAAATCTTGAATAACACCAGGGG + Intergenic
970939012 4:21609223-21609245 TAAATTTTGAATAAAATTATGGG + Intronic
971060827 4:22967261-22967283 AAAACCTTAATTAAAATTACTGG - Intergenic
971803751 4:31327480-31327502 TAAACTTTGAATAACACCATGGG + Intergenic
971828590 4:31660450-31660472 TAAACCTTGAGGAACATCACTGG + Intergenic
973006933 4:45020228-45020250 TAAACTATGAATAACAATAGAGG + Intergenic
973245628 4:48008280-48008302 TAGACCTAGAATAAAATGACTGG - Intronic
974276854 4:59731882-59731904 TTAACTTTGAATAATATTGCAGG - Intergenic
974874877 4:67691604-67691626 TAAACCTTGAATGACATCATGGG + Intronic
975509616 4:75179542-75179564 TACACCTTGAATAACACCATGGG - Intergenic
975602005 4:76111261-76111283 AAAACCTTGAATAACACCATAGG + Intronic
978420220 4:108524735-108524757 TAAACCTTGCATAACACCATGGG + Intergenic
979863774 4:125727109-125727131 TAAACCTTGAATAACATGATAGG - Intergenic
980183504 4:129432423-129432445 TGACCCTTGAACAACATGACAGG - Intergenic
980413391 4:132452827-132452849 TAAAGCTCAAATAACACTACAGG + Intergenic
981442854 4:144802860-144802882 AAAACCTTGAAAAACCTTTCTGG - Intergenic
981505081 4:145490811-145490833 TTAACCTTTAAAATCATTACAGG - Intronic
981571543 4:146156843-146156865 TAAACCTTGAATAATATCATGGG + Intergenic
981833365 4:149027709-149027731 TAAACCGGGAATAACATTGAAGG - Intergenic
981983465 4:150825729-150825751 TAAACCTTTGATAACATAATGGG + Intronic
982665497 4:158256633-158256655 TAAACCTTGGATAACACCATGGG - Intergenic
982747782 4:159122778-159122800 TAAACCTTGAATAATATTATGGG + Intronic
983248619 4:165319307-165319329 TAAACCTTGAATAATACCATGGG + Intronic
983435893 4:167714766-167714788 AAAAGCTTGCATAACATTTCAGG + Intergenic
984074951 4:175164780-175164802 TAAACCTTGAAGAACACCATAGG - Intergenic
986696325 5:10359139-10359161 TAAACTTTGAATAACATGATGGG + Intronic
986868467 5:12017532-12017554 TAAAACTTGTATCACAATACAGG - Intergenic
986934015 5:12860172-12860194 TAAATTTTAAATATCATTACAGG - Intergenic
987964040 5:24849259-24849281 TAAACCTTGACTAACACCATGGG - Intergenic
987997132 5:25298142-25298164 AAAACATTGAACAACATTATAGG - Intergenic
988220657 5:28342905-28342927 TAAACCTTGAATAACACCTTGGG + Intergenic
988400872 5:30758713-30758735 TAAACCTGGAATAACACCATGGG + Intergenic
988695693 5:33620319-33620341 TAAACCTTGAATAACACCATGGG - Intronic
989364570 5:40641390-40641412 CAAACCTTGAATAACATCACAGG + Intergenic
989462564 5:41717481-41717503 TAAACCTTAAATAATACTATGGG - Intergenic
989567086 5:42911284-42911306 TAAACCTGGAAGAACAGTCCTGG - Intergenic
989731262 5:44652744-44652766 TTAACCTTTAATAATATTATTGG - Intergenic
989732010 5:44660297-44660319 TAAACCTTGACTAACACCATGGG - Intergenic
990000787 5:50889878-50889900 TAAACCTTGAATAACAACATAGG - Intergenic
991314433 5:65284394-65284416 TAAGCCTTGAATAAAAATATGGG - Intronic
991650799 5:68851146-68851168 TAAACCTTGAATAACACCATGGG + Intergenic
992539437 5:77749094-77749116 TAAATCTTGAATAACACCATGGG - Intronic
993638693 5:90376541-90376563 TAAACCTTGGCTAACATCACAGG - Intergenic
993935460 5:93995357-93995379 TAAACCTTGAATAATACCATGGG + Intronic
994521633 5:100845245-100845267 TAAATCTTTGAAAACATTACAGG - Intronic
994729820 5:103478513-103478535 AAAACCTTGAAGAATAATACTGG + Intergenic
995069022 5:107896601-107896623 TAAACCAGGAATAACATCATGGG + Intronic
995137087 5:108691200-108691222 AAAACCTTGAAAATCATTAGAGG + Intergenic
995160677 5:108976942-108976964 TAAACCTTGAATAACACCATGGG - Intronic
995443964 5:112222468-112222490 AAAACAGTGGATAACATTACTGG - Intronic
995761167 5:115563813-115563835 TAAAACTTGAATAACTTGAGTGG + Intergenic
995788933 5:115862779-115862801 TAAACCTTGAATAACACTATGGG + Intronic
996079584 5:119241708-119241730 TAAACCTTGAATAACACCATGGG - Intronic
996570620 5:124929349-124929371 TAACCCTTGAATAGCAGTGCTGG + Intergenic
996614753 5:125427901-125427923 TAAACCTTAAATAACACCATAGG + Intergenic
996946919 5:129081441-129081463 TAAACCTTGAATGACACCATGGG + Intergenic
997165436 5:131656155-131656177 CAAACCCTGAATAACATCATGGG + Intronic
999412447 5:151363770-151363792 TAAATCTTGAATAACACCATGGG - Intergenic
1000250936 5:159494763-159494785 TAAAACTTGAAAACCATTAGTGG + Intergenic
1000512573 5:162201779-162201801 TAAACCTTGAATAACACCGTGGG - Intergenic
1003214137 6:4093588-4093610 TAAAACTTGAATAACACTATGGG + Intronic
1004446481 6:15704615-15704637 TAAACCTTGAATAACATTATGGG + Intergenic
1004575906 6:16894562-16894584 TAAACCTTGAATAACACCATGGG + Intergenic
1005407181 6:25501799-25501821 TAAATATTGAATAAGATTAATGG + Intronic
1006234106 6:32612673-32612695 TAAACCTTGAATAACACCATGGG - Intergenic
1006549581 6:34810230-34810252 TAAACCCTGAATAACACCATGGG - Intronic
1007732624 6:43957703-43957725 TAAACTTTGAATAACACCATGGG + Intergenic
1008654628 6:53599164-53599186 AAAACCTTGAATTACAGTAAGGG + Intronic
1008949294 6:57137883-57137905 TAAGCCTTGAAACACATTATGGG - Intronic
1008985745 6:57540999-57541021 TAAACCTTGAATAACACCATTGG + Intronic
1009173772 6:60433868-60433890 TAAACCTTGAATAACACCATCGG + Intergenic
1009859004 6:69301556-69301578 TAAATCTTGAATAACACCATGGG + Intronic
1010729126 6:79369100-79369122 TAAACCTTGAATAATACCATGGG - Intergenic
1010759289 6:79703859-79703881 TATACCTTGAATAGAATTGCTGG + Intergenic
1010960457 6:82140180-82140202 TAAAAATTGAATAGCATGACTGG + Intergenic
1011199366 6:84818106-84818128 TAAACCAGAAATACCATTACTGG - Intergenic
1011919800 6:92559306-92559328 TAAACCTCGAATAACACCATGGG + Intergenic
1012032634 6:94092034-94092056 TAGACCTTGAATAACATCATGGG + Intergenic
1012409480 6:98939753-98939775 TAAACTTTGAATAACACCATGGG - Intronic
1013554561 6:111242788-111242810 TAAACCTTGAATAACACCATGGG - Intergenic
1014594005 6:123310192-123310214 TAAACCTTGACTAAAATGATGGG + Intronic
1014926190 6:127273123-127273145 TAAACCTTGAATAACACCATGGG - Intronic
1015390467 6:132675867-132675889 CAAACCTTGAATAACACCATGGG - Intergenic
1015807191 6:137122214-137122236 TAAACCTTAAATATCATATCAGG - Intergenic
1016236698 6:141876492-141876514 TAAAGTTTGAATAACACCACGGG - Intergenic
1016316661 6:142796713-142796735 TAAACCTTGAATAACACCATGGG - Intronic
1017056365 6:150439733-150439755 TAAACCTTGAATAACATCATGGG + Intergenic
1018127927 6:160699734-160699756 TAAACCTTGAATAACACCATGGG + Intergenic
1018148506 6:160916664-160916686 TAAACCTTGAATAACACCATGGG - Intergenic
1019096803 6:169588002-169588024 TAAACCTTGAATTACACCATGGG - Intronic
1020193598 7:6019549-6019571 TAAACCTTGACTAACACTGTGGG + Intronic
1020843673 7:13255423-13255445 TAAACCTTAAATAACACCATGGG + Intergenic
1021062735 7:16133660-16133682 TAAACCTTGCATAACACCATGGG + Intronic
1021353017 7:19618080-19618102 TAAACCTTGAGTAACGCCACTGG - Intergenic
1021518304 7:21511041-21511063 TAAACCTTTTAGAACATTCCGGG - Exonic
1022061111 7:26796457-26796479 AAAACCTTGAATAACACCATGGG + Intronic
1022146047 7:27541723-27541745 TAAACCTTGAATGACACCATGGG - Intronic
1023645136 7:42303894-42303916 TTAACCTTGGATTACATTATTGG - Intergenic
1023769961 7:43547838-43547860 TAAACTTTGAATAACATTGTGGG - Intronic
1024711441 7:52019319-52019341 TAAAGCTTCAATTACAATACGGG - Intergenic
1026683559 7:72489049-72489071 TAATCCTTGAACCACATAACTGG - Intergenic
1027563789 7:79765780-79765802 TAATCCTTGATTAATTTTACTGG + Intergenic
1027867754 7:83669425-83669447 TAAACCTGGAATAACACCATGGG - Intergenic
1028298480 7:89166669-89166691 TAAACCTTAAATAACGCTATGGG - Intronic
1028378666 7:90174820-90174842 TAAAACTTGAAGAAAATTAATGG + Intronic
1028628877 7:92911091-92911113 TAAATCTTGAATAACATTATGGG + Intergenic
1030030741 7:105366983-105367005 TAAACTTTGAATAACACCATGGG - Intronic
1030251424 7:107449584-107449606 TAAACCTTGAAAAACTTCATAGG + Intronic
1032863109 7:135900346-135900368 TAAACCTTGAATAACACGATGGG - Intergenic
1033084395 7:138329074-138329096 TAAACCTTGAATAGCACCATTGG + Intergenic
1034862127 7:154607176-154607198 TAAACCTTAAATAAAACTATGGG + Intronic
1035913457 8:3594525-3594547 TAACCTTTGAAAAACATTCCTGG - Intronic
1037106006 8:15109533-15109555 GCAAATTTGAATAACATTACAGG + Intronic
1037148574 8:15606048-15606070 TAAACCTTGAATAACACCATGGG + Intronic
1037242961 8:16798375-16798397 TAAGCCTTGAATAACACCATGGG + Intergenic
1038028235 8:23611897-23611919 TAAACCTAGAATAAAAGAACTGG - Intergenic
1038110655 8:24493270-24493292 CAATCCTTTAAAAACATTACTGG + Intronic
1038502465 8:28057073-28057095 TAAATCTTGAATAACACCATCGG + Intronic
1039218020 8:35294887-35294909 TAAACTTCGAATAACACCACAGG - Intronic
1039769321 8:40667645-40667667 GAAACCTTGAATAACACCATGGG + Intronic
1040897092 8:52380049-52380071 TAAACCTTGAGTAACACCATGGG + Intronic
1041263474 8:56041879-56041901 TAAGCCTTGAATAACACCATGGG + Intergenic
1041359511 8:57037547-57037569 TAAACCTTTAGTAACATCATGGG + Intergenic
1041611920 8:59860457-59860479 TAAACCTTGAATAACACCATGGG - Intergenic
1041966440 8:63683944-63683966 CAAAGCTAGAATAACAGTACTGG - Intergenic
1042182606 8:66106583-66106605 CAAACCTTGAATAACACCACAGG - Intergenic
1042389315 8:68214821-68214843 TCAACCATGAATCAAATTACAGG + Intronic
1042664240 8:71188999-71189021 TAGACTTTGAAGAAAATTACAGG - Intergenic
1043844072 8:85143698-85143720 TAAACCTTAAATAAGGTTACAGG + Intronic
1045132856 8:99176440-99176462 TAAACCTTGAATAACACCACAGG + Intronic
1045218876 8:100177150-100177172 TAAACCTTAAATAACACCATGGG - Intronic
1045347522 8:101306816-101306838 TAATCCTTGAATAACACCATGGG - Intergenic
1045832302 8:106477172-106477194 TAAACTGTGAATAACACCACAGG - Intronic
1046125889 8:109907749-109907771 TAAACCTTGAATAACACCATGGG + Intergenic
1046270518 8:111890666-111890688 TAAACCTTAAGTAACATCATGGG - Intergenic
1047090557 8:121570241-121570263 TAAACCTTGAGTAACACCATGGG - Intergenic
1047321934 8:123794720-123794742 TAAACCTCAAATAACACTAGGGG + Intronic
1047598276 8:126400651-126400673 TAAACCTTGAATAACACCATGGG + Intergenic
1050224089 9:3431260-3431282 TAAACCTGGAATAACACCATGGG + Intronic
1050361173 9:4832437-4832459 TAAACATTAAATAACCCTACTGG + Intronic
1050958916 9:11702496-11702518 TAAGCCTTGATTTACATTCCTGG - Intergenic
1051116930 9:13706151-13706173 TGAAGCTTGGATAACATTGCTGG - Intergenic
1051130044 9:13850530-13850552 TAAACCTTGATTAACATGGAGGG + Intergenic
1052200532 9:25773363-25773385 TAAACTTTGAACAAAGTTACAGG + Intergenic
1054510989 9:65978804-65978826 TAAACTTTTAAAAACATTATGGG + Intergenic
1055314962 9:75025218-75025240 TAAACCTTAAATAACACCATGGG - Intronic
1055519259 9:77063963-77063985 TAAACCTTGAATAACACTATGGG + Intergenic
1059000732 9:110346036-110346058 TAAAGCTTGAATAACACCATGGG + Intergenic
1059109018 9:111537084-111537106 TAAATCTTGAATAACATCATGGG - Intronic
1059462318 9:114440882-114440904 TAAAGCTTGAATAACACCATAGG + Intronic
1060611141 9:124965839-124965861 TAAACCTTGCATAACACCATGGG - Intronic
1062330069 9:136037177-136037199 TAAACCTTGCATAAAATAAAAGG - Intronic
1185836738 X:3351643-3351665 TAAACCTTCAATGAAAATACGGG + Intergenic
1187121488 X:16411707-16411729 TAAACCTTGAATAACACCATGGG + Intergenic
1187776276 X:22761674-22761696 TAAACCTTGAATAACACCATGGG + Intergenic
1187816458 X:23237835-23237857 TAGACCTAGAATAAAATGACTGG + Intergenic
1187985841 X:24809955-24809977 TAAAACTTAAATATCATAACTGG + Intronic
1188712881 X:33423272-33423294 TAAACCCTGCATAACATCATAGG - Intergenic
1189449419 X:41114189-41114211 TAAACCTTGAATAACATTACGGG + Intronic
1191004629 X:55698207-55698229 TAAACCTTGAATAATACCATGGG - Intergenic
1192633902 X:72800689-72800711 TAAAATTTGAATAACAATCCAGG - Intronic
1192647808 X:72920112-72920134 TAAAATTTGAATAACAATCCAGG + Intronic
1193916390 X:87370180-87370202 TAAACTTTGAATAACACTATGGG + Intergenic
1194236561 X:91391299-91391321 TAAACCTGGAATAACACCATAGG + Intergenic
1194312780 X:92334546-92334568 TAAACCTTCAATAACACCATGGG + Intronic
1194752080 X:97696395-97696417 TAATCCTTGAATAACAACATGGG - Intergenic
1196408373 X:115390120-115390142 TAAACCTTGAATAACACCATGGG - Intergenic
1197411943 X:126126850-126126872 TAAACCTTGAATATCACCATGGG - Intergenic
1199076535 X:143532491-143532513 AAAATCTTGAAGGACATTACAGG + Intergenic
1199614262 X:149643564-149643586 TAAAACTTGAATAACACCATTGG - Intergenic
1200621048 Y:5448685-5448707 TAAACCTTCAATAACACCATGGG + Intronic
1201239887 Y:11948416-11948438 TAAACCTTCAATGAAAATACGGG - Intergenic
1201971504 Y:19802308-19802330 TAAACCTTGAGTAGCCTAACTGG + Intergenic