ID: 1189450693

View in Genome Browser
Species Human (GRCh38)
Location X:41126430-41126452
Sequence TATAAAATGAAAAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2169
Summary {0: 1, 1: 2, 2: 19, 3: 189, 4: 1958}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189450693_1189450696 -7 Left 1189450693 X:41126430-41126452 CCCTCTTCCTTTTTCATTTTATA 0: 1
1: 2
2: 19
3: 189
4: 1958
Right 1189450696 X:41126446-41126468 TTTTATACCTGCATTGTCCATGG 0: 1
1: 0
2: 0
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189450693 Original CRISPR TATAAAATGAAAAAGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr