ID: 1189451590

View in Genome Browser
Species Human (GRCh38)
Location X:41137340-41137362
Sequence TAGAATGCCTAAAATGATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189451590 Original CRISPR TAGAATGCCTAAAATGATCA CGG (reversed) Intronic
900551138 1:3256234-3256256 TAGAAGGACCAAAATCATCAGGG + Intronic
902149108 1:14428295-14428317 CAGAATGCCTATAATCATCCAGG - Intergenic
903892637 1:26580118-26580140 TAAAATGCAAAAAATGCTCAGGG - Intergenic
907704796 1:56823455-56823477 TAAAATGCCTAGAATTATCTTGG + Intergenic
908652642 1:66352750-66352772 TTGAATACCTAAAATGACCAGGG - Intronic
908731365 1:67229683-67229705 TAGAATGCCCAAAGTGGTAACGG - Intronic
909196531 1:72633510-72633532 TAAAATGTCTAAAATGAAAATGG - Intergenic
909244442 1:73260696-73260718 TATTATGCCTAAAATTATCCTGG + Intergenic
909325472 1:74346661-74346683 TAGAATGCCTGGCATAATCAGGG + Intronic
910529435 1:88218796-88218818 TAGAATGTCTTAAATTATCTGGG + Intergenic
911635541 1:100231416-100231438 AAGTATACCTAAAATGATTATGG - Intronic
912602960 1:110957072-110957094 TAGAATGCAGAAAATGAGTAAGG - Intronic
914421772 1:147534957-147534979 TAGAATGTCTATTATGAACATGG - Intergenic
916605161 1:166335244-166335266 GGGAATGCCTAAAATGAAAAAGG - Intergenic
916912311 1:169364158-169364180 TTGAGTGCCTAATATGATCTAGG + Intronic
917169013 1:172148553-172148575 TAGAAGGCCAAAAATAAGCAAGG - Intronic
922126543 1:222731289-222731311 TTGAGTGCCTAATATGTTCAAGG - Intronic
922286989 1:224179022-224179044 TAAATTTCCTAATATGATCATGG + Intronic
922828815 1:228540140-228540162 TAGAATGCCTGAAGTCACCAAGG + Intergenic
922828879 1:228540560-228540582 TAGAATGTCTAAAATCACCCAGG + Intergenic
922830015 1:228547717-228547739 TAGAATGCCTAAGTTCACCATGG + Intergenic
1063407051 10:5806192-5806214 TAGAATGGCTAAAATTAAAAAGG - Intronic
1063771055 10:9201404-9201426 CAGAATGCTTAAAATTATCTAGG + Intergenic
1065417358 10:25502823-25502845 TGGAATGGCAAAAATGATAAAGG + Intronic
1066199371 10:33130341-33130363 TAGAATTCCTAATATGAGCTGGG - Intergenic
1067896588 10:50187601-50187623 GAGAATACCTACAATGAGCAAGG + Intronic
1067952384 10:50754432-50754454 GAGAATACCTACAATGAGCAAGG - Intronic
1069175131 10:65280898-65280920 TAGAATTTCTAAGAGGATCATGG + Intergenic
1069313605 10:67070069-67070091 GAGAATGACTAAAATGAAAAAGG - Intronic
1070184173 10:74044762-74044784 TAGAATGGATAAAATAATCATGG + Intronic
1070212987 10:74346317-74346339 TAGAATGGCTATATCGATCAGGG + Intronic
1070551622 10:77494910-77494932 GAGAATGCCTATAAAGATGAAGG - Intronic
1072175314 10:92914953-92914975 TAAAATGCCTAAAAGTATGAGGG + Intronic
1072307937 10:94125631-94125653 TTGAATGCTTAAAATGAACCAGG - Intronic
1072538326 10:96379864-96379886 GAGAATGGCTAATGTGATCAAGG + Intronic
1074995219 10:118751181-118751203 TACAGTGCCTAAAATTAACAAGG - Intronic
1076211665 10:128651742-128651764 TAGAATGGCTAAAATTAAAAAGG + Intergenic
1077645733 11:3922189-3922211 TAGAATGGCTAAAATAAAAAAGG - Intronic
1079918704 11:26403816-26403838 TAAAATGCTTGAAATGTTCAAGG - Intronic
1080953793 11:37068177-37068199 TAGAATGCCTGAAATAGTCTTGG + Intergenic
1080993227 11:37567468-37567490 TAGAATGGCTAACATGAAAAAGG + Intergenic
1081213086 11:40359781-40359803 TAGACGGCATAAAATGCTCATGG - Intronic
1085093358 11:73738353-73738375 AAAAATGGCTAAAATGGTCAGGG + Intronic
1085659289 11:78348555-78348577 TAGAATGACTAAAATTAAAAAGG + Intronic
1085778392 11:79386715-79386737 CAGAATAGCTAAAATGAACACGG + Intronic
1085977014 11:81668639-81668661 TTGAATGCCTACCATGAACATGG - Intergenic
1086762228 11:90645881-90645903 TAAAATGACTGAAATGATAAAGG + Intergenic
1090156199 11:124441082-124441104 CAGAATGCCTTAAATGACAATGG - Exonic
1091217430 11:133911422-133911444 TAGAAGGCCTGAAATGATAGAGG + Intronic
1092551754 12:9509754-9509776 TGGTCTCCCTAAAATGATCAAGG - Intergenic
1094044453 12:26152089-26152111 TAGAATGAAGAAAATGATGAGGG - Intronic
1097952148 12:65443303-65443325 TCAAATGCCTGAAATGATTATGG + Intronic
1098945534 12:76585255-76585277 TTGAATTGCTATAATGATCAAGG + Intergenic
1099154429 12:79157080-79157102 TAGACTGCCTAGACTGATCCTGG + Intronic
1099274082 12:80553056-80553078 TTGAATGCCTACAATGTCCAAGG - Intronic
1101666608 12:106822248-106822270 GAGAATGACTAAAATGAAAAAGG + Intronic
1102483031 12:113236992-113237014 CAGAGTGCCTAAAATGCTGATGG + Intronic
1104591601 12:130088438-130088460 TAGAATGGCTAAAATGCAAAAGG + Intergenic
1106751818 13:32780263-32780285 TAGAATGCCTAAAAGAAAAAAGG - Intergenic
1107769569 13:43775566-43775588 TACAATGCCTAAACTGCTCCTGG + Intronic
1111527080 13:89486165-89486187 TAAAATGACTAAACTGATTAAGG + Intergenic
1111591282 13:90350474-90350496 AAGAAAGCATAAAATGATCTAGG - Intergenic
1111934668 13:94546869-94546891 AAGAATGCCTCAAGTGAGCATGG + Intergenic
1112247623 13:97748916-97748938 AAGAATGCCTCAAGTGAGCATGG + Intergenic
1112515452 13:100049312-100049334 TATAATATCTAAAATTATCATGG + Intergenic
1113243724 13:108370027-108370049 TGGAATGGCTAAAATGTTAAGGG - Intergenic
1113700197 13:112379399-112379421 TAAAATGCATAAAATGGCCATGG + Intronic
1114367317 14:22043421-22043443 TAGAATGGATAAAATAATAAGGG - Intergenic
1114711399 14:24781816-24781838 TTGAGTGCTTAAAATGAGCATGG - Intergenic
1116049876 14:39789687-39789709 TAGAATCCCTACAATTCTCATGG - Intergenic
1116200058 14:41781840-41781862 TAGAATACATAAAATGCTGAAGG - Intronic
1117256973 14:53987639-53987661 CAGAATAACAAAAATGATCAGGG - Intergenic
1119178821 14:72590106-72590128 TAGAATGTCTAAAATTAAAAAGG + Intergenic
1119831798 14:77709659-77709681 TAAATTGCCTAAAATGGTGAAGG - Intronic
1121886932 14:97551694-97551716 TACAATGCCTAAAACCATCTTGG + Intergenic
1123454167 15:20402110-20402132 TTAATTGCCTAAAAGGATCATGG - Intergenic
1124428230 15:29581772-29581794 TAGAATAGCTAAAATAATCCGGG + Intergenic
1124905461 15:33864008-33864030 TACAGTGACTTAAATGATCAGGG - Intronic
1126274003 15:46855000-46855022 TAGAATGCCAGAAATCATGATGG + Intergenic
1128817844 15:70627254-70627276 GAGACTTCCTAAAATAATCAAGG - Intergenic
1131960748 15:97788001-97788023 TAAAATGCCTACTATGAGCAAGG + Intergenic
1132408426 15:101559268-101559290 TGGAATGGCTAAAATAAACATGG - Intergenic
1134248796 16:12559815-12559837 TAGAATGCCAGAGATGATGATGG - Intronic
1137048405 16:35688736-35688758 TAGAATGCCTAGGATCACCAAGG + Intergenic
1141215306 16:82018292-82018314 TAGAATGACTAAAATAATTCTGG - Intergenic
1143942083 17:10552999-10553021 TTGAGTGACTGAAATGATCAAGG - Intergenic
1147912866 17:43867035-43867057 TAGAATGGTTAAAATGAAAAAGG - Intergenic
1148996688 17:51716404-51716426 AAGGATGTCTAAAATGCTCATGG + Intronic
1150199723 17:63342382-63342404 TAAAATGCCTACTATGTTCAAGG - Intronic
1151147431 17:72053952-72053974 TAAGATGTTTAAAATGATCATGG + Intergenic
1153220439 18:2855996-2856018 GAGAAAGGCTAAAATGCTCACGG + Intronic
1153592832 18:6692207-6692229 TACAATGCCGAAAAAGATTAGGG + Intergenic
1154034797 18:10790482-10790504 TAGCAGGTCTAAAATTATCAAGG + Intronic
1154262177 18:12845109-12845131 TAAAATGGCTAAAATGATCTTGG - Intronic
1155203697 18:23538867-23538889 TAGTATGCCTAAGATGAAAATGG - Intronic
1155569423 18:27175367-27175389 TAAAATTCCTGAAATTATCAAGG + Intronic
1156083756 18:33374454-33374476 TATAATGCCTAAAATTATAAAGG + Intronic
1159316395 18:66779288-66779310 TAGTATGCAACAAATGATCAAGG + Intergenic
1159788335 18:72742809-72742831 TAGAATTGCTAAGATGACCAAGG + Intronic
1159864850 18:73691720-73691742 AAGAACGCCTCAAATGAGCATGG + Intergenic
1160128393 18:76201767-76201789 TAGAATAGCTAAAATAATCTTGG + Intergenic
1164381117 19:27737827-27737849 TAGAATGCCTAGGATCGTCAGGG + Intergenic
1167782765 19:51610904-51610926 TAGAATGCCTGAAAAGAAAATGG - Intergenic
1168542799 19:57227047-57227069 TAAAATGTCAAAAATGATTAAGG - Intergenic
925536127 2:4918642-4918664 CAGATTGCCTAAATTGCTCAAGG - Intergenic
926029150 2:9570401-9570423 TAGAAGGCCTTAAGTGATAAAGG - Intergenic
926481120 2:13397108-13397130 TTAATTGCCTAAAAGGATCATGG + Intergenic
926817081 2:16809160-16809182 TAGAATGGCTATAATGAAGAAGG + Intergenic
927622100 2:24672181-24672203 AAAAATGCTTAAAATGATTATGG + Intronic
929488801 2:42378467-42378489 TGGAATCACTAAAATGATTATGG + Intronic
930997455 2:57737616-57737638 TAGACTATTTAAAATGATCAAGG - Intergenic
932484198 2:72071810-72071832 TAGAATGACTAAAATTAAAAAGG - Intergenic
932617424 2:73242623-73242645 TACAATACTTAAAATAATCATGG - Intronic
937350618 2:121158502-121158524 CATAATGCCTAAAATGACAAAGG - Intergenic
938872385 2:135493634-135493656 TTGAATGCCTAAAATAAAAAAGG + Intronic
939463019 2:142521781-142521803 TAGAATGCAGAAAAGGATGATGG + Intergenic
940495349 2:154420711-154420733 TAGAGTGCTTAAAATGGTTATGG - Intronic
941217534 2:162732293-162732315 GAGAATGCCACCAATGATCAAGG + Intronic
942654333 2:178198870-178198892 TACAATAGCTAAAATGACCAAGG + Intronic
943829188 2:192437196-192437218 TGGAATGCCTAAAACCAACAAGG - Intergenic
948250718 2:236526485-236526507 GGGAATGCAAAAAATGATCAAGG - Intergenic
1168982447 20:2018645-2018667 TAGAATGGCTAAAATTAAGAAGG + Intergenic
1169629712 20:7616937-7616959 TACAATGGCTAAAATGAGCAGGG + Intergenic
1170369127 20:15629271-15629293 TAAAATGGCTAAAATTAACAAGG - Intronic
1173312727 20:41914793-41914815 TATACTGCCTAAAATGAGCCAGG + Intergenic
1173522948 20:43712569-43712591 TACAATGCCTAATACAATCAAGG - Intronic
1178999093 21:37438019-37438041 TAGAATGGCTAAAATTAAAAAGG - Intronic
1180237099 21:46469196-46469218 TAAAATGCCTAAAATGTGCAAGG - Intronic
1181183386 22:21083081-21083103 CAGAATGCCAAAAATGGTTAGGG - Intergenic
1181390754 22:22579278-22579300 TAGAATGACTAATGTGCTCAAGG + Intergenic
1181775534 22:25157690-25157712 AAAAATGCCCAAAATAATCAGGG - Intronic
1183143418 22:35966508-35966530 CAGAATGACTAAAATGAAAAAGG - Intronic
1183917272 22:41131821-41131843 TATAATGCAAAAAAGGATCAAGG - Intronic
949477548 3:4463103-4463125 CAGAATGCCTAAAATGTATAAGG + Intronic
949695110 3:6685267-6685289 GAGCCTGCCTAAAATGATCCAGG + Intergenic
950461751 3:13126695-13126717 TAGGATGGCTAAAATGAAAATGG - Intergenic
953134331 3:40169759-40169781 TAAAATGCTTAGAATGCTCAAGG + Intronic
954848898 3:53583567-53583589 TATACTGCCTAAGATGAGCATGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955449916 3:59055316-59055338 TACAATGACATAAATGATCAAGG + Intergenic
957351085 3:79022512-79022534 AAGAATGCCTGAAATGCTCATGG + Intronic
958045995 3:88284473-88284495 TAAAAAGCCTAAAATGAAAAAGG - Intergenic
958663785 3:97107040-97107062 TTAAATACCTATAATGATCAAGG - Intronic
961680065 3:128594070-128594092 TGGAATGCCTCATCTGATCATGG - Intergenic
962105990 3:132389975-132389997 TTAAATACCTAAAATGATTATGG - Intergenic
963189814 3:142456748-142456770 TAGAATGGCTAAAATAAAAAAGG + Intronic
965277965 3:166712028-166712050 AATAATGCCTAACATGATTATGG + Intergenic
965634801 3:170770086-170770108 TACAATGCCCTAAATGCTCATGG + Intronic
967046881 3:185745580-185745602 AAGAATGCCTAAGATGATTCAGG + Intronic
967506435 3:190257973-190257995 TAGAATGCCTATAATAACCTAGG + Intergenic
968383485 4:114650-114672 TAAAATGGCTAAAATGAAAATGG - Intergenic
971664235 4:29460922-29460944 AATAATACCAAAAATGATCATGG + Intergenic
971909280 4:32774330-32774352 TAAAATACATAAAATGATAATGG - Intergenic
972116417 4:35640567-35640589 TGTAATGCCTAATATGTTCAAGG + Intergenic
974316578 4:60289955-60289977 TAAAATGCCTGAAAAAATCAAGG + Intergenic
974350649 4:60741135-60741157 TTGAAAGTCTAAAATGACCAGGG + Intergenic
974882761 4:67780093-67780115 TAGAAACCCTATAATGTTCATGG + Intergenic
975587028 4:75960065-75960087 GAGAATGCTGAAAATGATGAAGG - Exonic
977297610 4:95228282-95228304 TAGATAGCAAAAAATGATCATGG + Intronic
977377555 4:96225788-96225810 TAGAATGTCTAAAATTAAAATGG + Intergenic
977542457 4:98333618-98333640 TAGATTGCCTGAAAAGTTCATGG + Intronic
978380129 4:108118159-108118181 TGGTATGCTTAAAAGGATCATGG - Intronic
979093958 4:116520456-116520478 AAGAATGCCTCAAGTGAGCATGG - Intergenic
980269098 4:130561451-130561473 TAAAGTGCATAAAATGTTCATGG - Intergenic
981073055 4:140565386-140565408 TAGAAAGCAAGAAATGATCAGGG - Intronic
983117469 4:163836101-163836123 TATAATGCCAAAAATTGTCATGG + Intronic
983651263 4:170039200-170039222 TAGAAAGAGCAAAATGATCATGG - Intergenic
983859273 4:172685050-172685072 TAGAATGCTTAATATGTGCAAGG - Intronic
984994605 4:185417328-185417350 TAGAATGCATAAAATAATTGTGG - Intronic
985420069 4:189776383-189776405 TAAAATGTCTCAAATGAGCATGG - Intergenic
987689419 5:21247453-21247475 TAAAATTCCTATAATTATCAGGG - Intergenic
990811431 5:59728826-59728848 TAGATTTCCTAATTTGATCAGGG + Intronic
991156816 5:63446736-63446758 TTGAATGCCTACAATGCTCTTGG + Intergenic
991164889 5:63554202-63554224 AAGAACACCTAAAATGAGCATGG + Intergenic
991586390 5:68206394-68206416 TAGAATGGCTAAAATTATAAAGG - Intergenic
992577243 5:78127111-78127133 TAGAATTTCTATAATGATCATGG - Intronic
994619140 5:102142197-102142219 TAGAAGGCCTAAAATAAAAACGG - Intergenic
994709616 5:103251077-103251099 TATAATGGCTAAAATAATCTTGG - Intergenic
994793875 5:104268198-104268220 GAGAATGCCTAAACTGATACTGG + Intergenic
994867534 5:105295856-105295878 TTGAGTGCCTAAAATGATCCAGG + Intergenic
996424309 5:123296058-123296080 TAGAATACCTAGAATGATTCAGG + Intergenic
996618296 5:125468444-125468466 TTGAATGCCAAAAATACTCATGG + Intergenic
997007161 5:129831756-129831778 TAGAGTGACTAAAATGAAGAAGG - Intergenic
998705621 5:144756370-144756392 TACAATGTCTAAAATGAAAATGG - Intergenic
1000919788 5:167124457-167124479 TTGAATGCCTACAATGGGCAAGG - Intergenic
1006664955 6:35687283-35687305 TAGAATCTCTAAATTGGTCAGGG + Intronic
1007117789 6:39356102-39356124 TAGCATGCCTCAAATTGTCAAGG - Intronic
1008147002 6:47904013-47904035 GAGACTGCCTGAAATGTTCAAGG + Intronic
1008184926 6:48376856-48376878 TGAAATGCCTAAAATGACCAAGG + Intergenic
1008885758 6:56430492-56430514 TAAAATGCCAAAAATGATCTAGG - Intergenic
1010672341 6:78700722-78700744 TGGAATGCCTAAAATGTACCCGG - Intergenic
1010908290 6:81520506-81520528 TAGGAAGCCTAATATGATGATGG - Intronic
1010971124 6:82264423-82264445 TGGAATGCCTAGAATGAACATGG - Intergenic
1012390535 6:98733137-98733159 TATAATGCTTAAAATGCTAATGG + Intergenic
1013280390 6:108630915-108630937 TAGAATGCAAAAAATAATCTTGG + Intronic
1014638982 6:123884859-123884881 TAAAATGACTGAAATGATCGAGG - Intronic
1015203145 6:130604532-130604554 TACAATGCTTAAGATGATCTTGG - Intergenic
1015427557 6:133089491-133089513 TAGATGGCCTAAAAGAATCATGG + Intergenic
1017359506 6:153550405-153550427 TTGAACTCCTAAAAAGATCATGG + Intergenic
1018543396 6:164908795-164908817 TAAAATGACCAAAATGAACAGGG + Intergenic
1019585375 7:1799230-1799252 CAGAATGGCTAAAATGAAAAAGG + Intergenic
1020702989 7:11506688-11506710 TAGAATGCTTAAAGTGTTCCAGG - Intronic
1021496814 7:21284068-21284090 TAGAATTCATAAGATTATCAGGG + Intergenic
1022623664 7:32011644-32011666 TAGAATGGCTAAAATTAAAAAGG + Intronic
1022876394 7:34536369-34536391 TACAAGGCTTAAAATGAACAGGG + Intergenic
1024696545 7:51862702-51862724 TAGAAGGATTGAAATGATCATGG + Intergenic
1026021487 7:66710556-66710578 TAGAATGGCTAAAATTAAAAGGG - Intronic
1026435889 7:70397359-70397381 TAGAATGGCTAAAATGAGGCTGG - Intronic
1026885951 7:73945497-73945519 TAGAATGGCTAAAATTAAAAGGG - Intergenic
1030546024 7:110896303-110896325 TAGATTGCATAAAATGTTAAAGG + Intronic
1031177428 7:118370879-118370901 TAGCATCACTAAAATGGTCAGGG - Intergenic
1031767370 7:125798416-125798438 TAGAATGGCTAAAATTATAAAGG - Intergenic
1033808755 7:144984932-144984954 TAGAATGTCCAAAAAGATAAAGG - Intergenic
1033930251 7:146510558-146510580 GAAAATATCTAAAATGATCAAGG - Intronic
1034508329 7:151514486-151514508 TAGGATGGCTAAAATGAAAAAGG + Intronic
1034777703 7:153846160-153846182 TAGAATGGCTAAAATTAAAATGG - Intergenic
1035152943 7:156890658-156890680 TAGAATGACTAAAATTAAAAAGG + Intronic
1035936008 8:3840456-3840478 TTGAATGCCTATTATGTTCAGGG - Intronic
1036288382 8:7464311-7464333 TAAAATGCTTAAAAAGATGAAGG - Intergenic
1036333093 8:7847217-7847239 TAAAATGCTTAAAAAGATGAAGG + Intergenic
1037792846 8:21961957-21961979 TAGAATGACTAAAATGAGGCAGG - Intronic
1037822681 8:22142460-22142482 CAGAATGCCTCAAATCATCGCGG - Intergenic
1038147019 8:24906528-24906550 TAGATTACCTAAAATTATTAAGG - Intergenic
1039781014 8:40785601-40785623 TAGATTGTCAAAAATGATGAGGG - Intronic
1042898984 8:73702858-73702880 TAGAATGGCTAAAATTAGAAAGG + Intronic
1043669686 8:82866963-82866985 TAGGAAGCCTATAATGATGAAGG + Intergenic
1045623898 8:104018773-104018795 TATAATGGAAAAAATGATCATGG - Intronic
1045670174 8:104542169-104542191 TAGGATGGCTAAAATGAAAAAGG - Intronic
1046119994 8:109833849-109833871 TAAAATACCTAAAATAAGCAAGG + Intergenic
1046624627 8:116563325-116563347 TATAATGCCAAAGATGGTCATGG - Intergenic
1047269386 8:123341096-123341118 TAAAATGAATAAAATGAGCATGG - Intronic
1047595570 8:126374557-126374579 TAGAAGGCCTAAAATGTCCAGGG + Intergenic
1048565720 8:135594710-135594732 TAGAATGACTAAAATTAAAAAGG + Intronic
1049931861 9:464719-464741 TACAATTCCAAAAATCATCATGG + Exonic
1050627532 9:7520938-7520960 GTGAATGCCTAAAATGTTAATGG + Intergenic
1053038067 9:34842893-34842915 TAGAATGGCTAAAATTAAAAAGG - Intergenic
1055108099 9:72533239-72533261 TATAATGCATAAAGTGATAAAGG + Intronic
1057296663 9:93848901-93848923 TAGAATGGCTAAAATGAAAGAGG - Intergenic
1057366753 9:94429573-94429595 TAGTATACCTAAAAAGATGATGG - Intronic
1058759888 9:108120365-108120387 TAGAGGGACAAAAATGATCATGG + Intergenic
1059012147 9:110473361-110473383 AAGCTTGCCTAAAATGTTCATGG - Intronic
1060858141 9:126932209-126932231 TAGAATGGCTAAAATGAAGGGGG + Intronic
1186299565 X:8185073-8185095 TTGAATGCCTGAAATGTGCAAGG + Intergenic
1187282690 X:17871248-17871270 TAGAATGGCTAAAATAAAAATGG - Intergenic
1187429190 X:19206163-19206185 TAGAATGAAAAAAATGATCTTGG + Intergenic
1188115934 X:26242572-26242594 TAGAATGGCTAAAATTAAAAAGG - Intergenic
1189451590 X:41137340-41137362 TAGAATGCCTAAAATGATCACGG - Intronic
1190148493 X:47920462-47920484 TAGAAGGCCTTTAATGATCTGGG + Exonic
1190793752 X:53722628-53722650 TAGAATGACTAAAATTAAAAAGG - Intergenic
1191234429 X:58122735-58122757 TAGAATGCCTGAGATGAGCCAGG - Intergenic
1191240716 X:58188028-58188050 TAGAATGCCTGAGGTCATCAAGG - Intergenic
1191243578 X:58208343-58208365 TAGAATGCCTGAAGTCACCAAGG - Intergenic
1191247984 X:58243058-58243080 TAGAATGCCTAAAATAGGCAAGG - Intergenic
1191248648 X:58247906-58247928 TAGAATGCCTGAGGTGATCCAGG - Intergenic
1193060340 X:77199322-77199344 TTTGATGCCTAAAATGTTCATGG + Intergenic
1193493226 X:82176485-82176507 AAGAATGCTCAAAATCATCAGGG - Intergenic
1196129210 X:112135225-112135247 GAGAATGCCTAAAATTAAAAAGG - Intergenic
1197644023 X:128998046-128998068 TAGAAGCCATAAAAGGATCATGG + Intergenic
1199286964 X:146064588-146064610 TCTGATACCTAAAATGATCAAGG - Intergenic
1200314211 X:155114838-155114860 AAGAATGCCTAAAGAGATAATGG + Intronic