ID: 1189455451

View in Genome Browser
Species Human (GRCh38)
Location X:41184103-41184125
Sequence TGTTAGATATAGCACTTGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189455451_1189455453 -8 Left 1189455451 X:41184103-41184125 CCTCACAAGTGCTATATCTAACA 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1189455453 X:41184118-41184140 ATCTAACAGAGGTTAGTTTTTGG 0: 1
1: 0
2: 4
3: 25
4: 166
1189455451_1189455455 -6 Left 1189455451 X:41184103-41184125 CCTCACAAGTGCTATATCTAACA 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1189455455 X:41184120-41184142 CTAACAGAGGTTAGTTTTTGGGG 0: 1
1: 0
2: 10
3: 116
4: 559
1189455451_1189455454 -7 Left 1189455451 X:41184103-41184125 CCTCACAAGTGCTATATCTAACA 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1189455454 X:41184119-41184141 TCTAACAGAGGTTAGTTTTTGGG 0: 1
1: 0
2: 0
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189455451 Original CRISPR TGTTAGATATAGCACTTGTG AGG (reversed) Exonic
903644940 1:24889512-24889534 TGCTAGATAAAGAACTTGGGTGG - Intergenic
907303093 1:53500411-53500433 TGTTCTCTAGAGCACTTGTGTGG - Intergenic
916466685 1:165080288-165080310 TGCTGGATATTGCACTTGTAGGG + Intergenic
918931932 1:190865170-190865192 TGTAAGCTAAAGCACTTTTGTGG - Intergenic
1063508211 10:6621008-6621030 TGGTAGATAAAGCAATTGTACGG - Intergenic
1064580188 10:16785972-16785994 TGTCAGATATCCCAATTGTGGGG - Intronic
1065488581 10:26258259-26258281 TGTTAGACATATCCCCTGTGAGG - Intronic
1065973805 10:30825299-30825321 TGTGAGATATAGGACATGTTTGG + Intronic
1069553744 10:69383005-69383027 TTTTAGAGATAGCACTTGCCTGG - Intronic
1071403730 10:85306403-85306425 ACTTAGATATATCACTTTTGAGG - Intergenic
1071700144 10:87922733-87922755 TCTTAGATATTGTACTTTTGAGG + Intronic
1073762722 10:106648138-106648160 TGGTAGATATAGGAATGGTGCGG - Intronic
1079608297 11:22397810-22397832 TGTGGGAGATAGGACTTGTGAGG + Intergenic
1079968024 11:27002681-27002703 ATTTAGATACAGCTCTTGTGAGG - Intergenic
1080066661 11:28023837-28023859 TGTTTGATGTAGAACTTGAGAGG + Exonic
1080198226 11:29636767-29636789 TCTTACTTATAGCCCTTGTGAGG - Intergenic
1087829594 11:102804702-102804724 TGTCAGATATATCAATTGTGAGG - Intergenic
1088323823 11:108581955-108581977 TGATAGATATAGAACTTTTTCGG - Intronic
1093592112 12:20915240-20915262 TATTAGATAGAGCACTGCTGAGG - Intronic
1097330322 12:58325941-58325963 TGTTAGATATGGCTCATGTTTGG + Intergenic
1105668498 13:22586889-22586911 TGTGAAATTTAGCACTTGTGGGG - Intergenic
1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG + Intronic
1107266885 13:38566537-38566559 TGCTAAATATAGTACTGGTGGGG + Intergenic
1110712941 13:78669983-78670005 CGTTAAGTATAGCACTTGTTAGG - Intergenic
1111012737 13:82332038-82332060 TGTAAGACAAAGGACTTGTGAGG - Intergenic
1111889081 13:94059431-94059453 TGTTACAAGTAGCACTTCTGTGG - Intronic
1113075615 13:106465084-106465106 TGTTACATATAGCAATTATAGGG - Intergenic
1115358129 14:32471659-32471681 TATTAGCTATAGCCCTGGTGGGG - Intronic
1120324784 14:83010080-83010102 TGCTAGATTTAGGACTTGTAAGG + Intergenic
1124025805 15:25964503-25964525 TGTTAGATAACACACTTGTGAGG + Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1126989960 15:54363002-54363024 TCTGAGATCTTGCACTTGTGGGG - Intronic
1131982469 15:98007965-98007987 TTTTGGAAATAACACTTGTGTGG - Intergenic
1133710529 16:8397078-8397100 TGGTAGCTATAGCAGTTGTTAGG - Intergenic
1135376496 16:21952120-21952142 TGTTAAATCTACCACATGTGGGG + Intergenic
1139314620 16:66057704-66057726 AGTTAGATAAACCAATTGTGAGG + Intergenic
1148511480 17:48174240-48174262 TGTTAGATAAAACAGATGTGGGG - Intronic
1151005313 17:70429392-70429414 TGTTAGCTATAGGATTTTTGTGG - Intergenic
1155863091 18:30928982-30929004 TGATAGTTGAAGCACTTGTGAGG - Intergenic
1158527611 18:58229242-58229264 TGTAAGAAATGGCATTTGTGTGG - Intronic
1158994245 18:62900801-62900823 TGTGAGATATTTCACTTTTGTGG - Intronic
1159358572 18:67370035-67370057 TGTCAGATATAGAACTTCGGTGG + Intergenic
1159823970 18:73182567-73182589 TGTTAGTTCTAGCAGTTCTGGGG - Intronic
1160446648 18:78933247-78933269 TGTTAGAGATGACACTAGTGTGG + Intergenic
1163891002 19:20013534-20013556 TCTTGGATATACCACTTGTTAGG + Intronic
927068636 2:19501245-19501267 TGATAAAAATAACACTTGTGTGG - Intergenic
930414204 2:51069363-51069385 TATTAGGGAAAGCACTTGTGCGG + Intergenic
930778016 2:55194651-55194673 TGTTAGTTCTAGTACTTCTGTGG - Intronic
932530275 2:72522957-72522979 TGTTAGTTCTAGCATTTGTATGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934163310 2:89272480-89272502 TGTTAGAAATAACATTTCTGTGG - Intergenic
934203963 2:89910044-89910066 TGTTAGAAATAACATTTCTGTGG + Intergenic
935251376 2:101264963-101264985 TGTTAAGAATAGCACTGGTGTGG + Exonic
938007145 2:127796389-127796411 TGTGAGAGATAGCACTACTGTGG + Intronic
938890765 2:135702949-135702971 TGTTAGAGACAGCACTTTAGTGG - Intronic
941671874 2:168302461-168302483 TTTTTGATATAGCACTGGGGAGG + Intergenic
942327209 2:174786062-174786084 TGTTAGATATAACATATCTGGGG - Intergenic
945096036 2:206220419-206220441 TGTTAGATATAAAAACTGTGAGG + Intergenic
945179683 2:207079172-207079194 TGGCAGCTATAGCATTTGTGAGG + Exonic
945488700 2:210428779-210428801 TGTTAGACAAAGCATTTGTGAGG - Intergenic
945872413 2:215242332-215242354 TGTTGGATAGAGCAATTGTGGGG - Intergenic
947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG + Intergenic
947609239 2:231513096-231513118 TGTTTGCAATAGCACTTTTGAGG + Intergenic
1168816952 20:744336-744358 TGTAAGATATAGCTGTTGGGAGG - Intergenic
1170971168 20:21117835-21117857 TGTTAGAGATTGTACGTGTGTGG - Intergenic
1173067754 20:39729284-39729306 TGTTGGATTTTGAACTTGTGTGG + Intergenic
1175906522 20:62382545-62382567 AGTTATATATAGCAATTGCGGGG + Intergenic
1179983496 21:44908533-44908555 TGATAGATAGAGCAAGTGTGGGG - Intronic
1180764013 22:18232902-18232924 TGTGATATATAACACTTGAGGGG - Intergenic
1180771631 22:18391640-18391662 TGTGATATATAACACTTGAGGGG + Intergenic
1180803008 22:18641254-18641276 TGTGATATATAACACTTGAGGGG + Intergenic
1181218707 22:21354006-21354028 TGTGATATATAACACTTGAGGGG - Intergenic
1203233468 22_KI270731v1_random:132631-132653 TGTGATATATAACACTTGAGGGG + Intergenic
951948395 3:28168932-28168954 TGTTAGCTCTACCATTTGTGTGG + Intergenic
953710886 3:45269698-45269720 CGTTAGAAATAGCACTCATGAGG + Intergenic
954941428 3:54376452-54376474 TGTTTTATAGAGCAGTTGTGAGG + Intronic
956932295 3:74058292-74058314 CTTTAAATATAACACTTGTGGGG + Intergenic
959346295 3:105198983-105199005 TGCTATATATATCACATGTGGGG - Intergenic
960114102 3:113875941-113875963 TGTTAGATAGAGGAGTTGTTGGG + Intronic
962165880 3:133047358-133047380 TGTCAGAAATAGCACTTGGCTGG + Intronic
965068388 3:163882918-163882940 TTTTAGATATAGCACTACTGGGG - Intergenic
965387501 3:168062592-168062614 TTTTAAATAGAGCATTTGTGAGG - Intronic
969152026 4:5177748-5177770 TGTTGGATTTTGGACTTGTGTGG - Intronic
971448163 4:26774857-26774879 TCTTAGATTAAGAACTTGTGAGG - Intergenic
971744913 4:30566874-30566896 TGTTGGATTTCGGACTTGTGTGG + Intergenic
972658576 4:41091226-41091248 AGTTAGATATAGTCCTTGCGAGG + Intronic
975264464 4:72345688-72345710 TGTTAGAATTAGAACTTTTGGGG - Intronic
975337317 4:73194005-73194027 TGTTTGATAAAGGACTTGTTTGG - Intronic
977760516 4:100730504-100730526 TGGTACATATGTCACTTGTGAGG - Intronic
978513204 4:109543761-109543783 TGTTACATATTCAACTTGTGAGG + Intergenic
980749371 4:137069465-137069487 TGTTATAGATAGCTTTTGTGTGG + Intergenic
981655852 4:147111880-147111902 TCTTAGATATAGAATTGGTGGGG - Intergenic
983592617 4:169430813-169430835 TGTTAAAAATATCACTTGTCAGG + Intronic
986014746 5:3748056-3748078 TGTTGGATTTTGAACTTGTGTGG + Intergenic
986739475 5:10693511-10693533 AGTTAGATACAGCACTTCTAAGG - Intronic
987759079 5:22135806-22135828 TATTAGATAAAACAGTTGTGAGG + Intronic
987883670 5:23783519-23783541 TGTGAGATACAGAATTTGTGGGG + Intergenic
989743925 5:44805624-44805646 TGTTAGACATAGGAGTTGAGTGG - Intergenic
991893791 5:71369252-71369274 TATTAGATAAAACAGTTGTGAGG + Intergenic
997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG + Intronic
998423681 5:142009804-142009826 TGTTAGATGTAGCACCTGTCAGG - Intronic
999337278 5:150732882-150732904 TTTTACATAGTGCACTTGTGTGG - Intronic
1003655243 6:8001176-8001198 CATTAAATATAGCACATGTGAGG + Intronic
1004950114 6:20660094-20660116 TGTCAGAGATAACACCTGTGGGG + Intronic
1007156096 6:39745442-39745464 TGTAAGAAATTACACTTGTGAGG - Intergenic
1011948238 6:92934170-92934192 TGTTAGATTTCGGACTTGTATGG - Intergenic
1014092505 6:117419976-117419998 TGTTAGCTATTGTAATTGTGAGG - Intronic
1015110593 6:129588083-129588105 TGTTGGATTTCGGACTTGTGTGG - Intronic
1017997493 6:159545078-159545100 TGTTAGAAAAAGCAGTTGTTAGG + Intergenic
1019759436 7:2799229-2799251 TGTCAGATATGGCAGATGTGTGG - Intronic
1024126003 7:46295137-46295159 TGTTAGATATGGTACTGCTGGGG - Intergenic
1024195619 7:47055733-47055755 TGTAATATATAGCATCTGTGTGG - Intergenic
1027527013 7:79282192-79282214 AGGTATATACAGCACTTGTGAGG + Intronic
1032967142 7:137111291-137111313 TGTTACATCTAGGACTTGTGTGG - Intergenic
1036986737 8:13540526-13540548 TGTAAGAGATGGCACTTGTCTGG - Intergenic
1039274236 8:35917803-35917825 TGTTAGATATGCAAATTGTGAGG - Intergenic
1040462616 8:47663257-47663279 TGTGAGAGATAGCACTGGGGTGG - Intronic
1043229327 8:77781008-77781030 TGTAAGATATAGCATTTGTGTGG + Intergenic
1047432844 8:124807521-124807543 TGTTAGATGTATCACTGGTTGGG - Intergenic
1047993599 8:130312395-130312417 TGTTAGATTTAGCTCTCGTCTGG - Intronic
1048612612 8:136040168-136040190 TGTTAGAAAAAGCATATGTGAGG - Intergenic
1050296396 9:4209610-4209632 TGTTAATGATAGCACTTGTCAGG + Intronic
1050821337 9:9883679-9883701 GGTTAGATAGAGTACATGTGAGG - Intronic
1051409117 9:16770584-16770606 TGTTAGATGTAGAACTTCTCAGG - Intronic
1053392749 9:37747378-37747400 TTTCAGATAAAGCACATGTGTGG - Intronic
1054822176 9:69533811-69533833 TGTAAAATATAGAACTTGTTGGG - Intronic
1185975571 X:4715638-4715660 TGTTACATAGAGCAGCTGTGTGG - Intergenic
1189455451 X:41184103-41184125 TGTTAGATATAGCACTTGTGAGG - Exonic
1193555034 X:82943294-82943316 TTTTAGATATAGAATTTGTGGGG + Intergenic
1194579634 X:95655993-95656015 TTTTTGATATAGCAGTTATGTGG - Intergenic
1194610392 X:96036001-96036023 TGTCAGTAATAACACTTGTGAGG - Intergenic
1194985118 X:100481774-100481796 TGTTAGATATATGACTTTGGAGG - Intergenic
1197108927 X:122749178-122749200 TTATAGATATAGAACTTTTGAGG + Intergenic
1198071364 X:133151713-133151735 TGTTAGAAATACAAATTGTGGGG + Intergenic
1198942045 X:141966518-141966540 TATTAGATTTTGCACTTGCGTGG + Intergenic
1199066617 X:143426381-143426403 TGTTACATGTGGCACTTCTGGGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic