ID: 1189462473

View in Genome Browser
Species Human (GRCh38)
Location X:41253557-41253579
Sequence ACCTTGACCCGTGGGGGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189462463_1189462473 7 Left 1189462463 X:41253527-41253549 CCTTAGGTGCCCAGACCCAAAGT No data
Right 1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG No data
1189462465_1189462473 -2 Left 1189462465 X:41253536-41253558 CCCAGACCCAAAGTCAAGAGGAC No data
Right 1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG No data
1189462462_1189462473 8 Left 1189462462 X:41253526-41253548 CCCTTAGGTGCCCAGACCCAAAG No data
Right 1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG No data
1189462461_1189462473 15 Left 1189462461 X:41253519-41253541 CCTACTTCCCTTAGGTGCCCAGA No data
Right 1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG No data
1189462467_1189462473 -8 Left 1189462467 X:41253542-41253564 CCCAAAGTCAAGAGGACCTTGAC No data
Right 1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG No data
1189462466_1189462473 -3 Left 1189462466 X:41253537-41253559 CCAGACCCAAAGTCAAGAGGACC No data
Right 1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG No data
1189462459_1189462473 29 Left 1189462459 X:41253505-41253527 CCTGCAAGCTCTTTCCTACTTCC No data
Right 1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG No data
1189462468_1189462473 -9 Left 1189462468 X:41253543-41253565 CCAAAGTCAAGAGGACCTTGACC No data
Right 1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189462473 Original CRISPR ACCTTGACCCGTGGGGGTCG TGG Intergenic
No off target data available for this crispr