ID: 1189466656

View in Genome Browser
Species Human (GRCh38)
Location X:41282675-41282697
Sequence ACTTTTGAAATTTTTATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189466656_1189466658 2 Left 1189466656 X:41282675-41282697 CCACTGATAAAAATTTCAAAAGT No data
Right 1189466658 X:41282700-41282722 GAAAACCAATCTATGTTGTTAGG No data
1189466656_1189466662 27 Left 1189466656 X:41282675-41282697 CCACTGATAAAAATTTCAAAAGT No data
Right 1189466662 X:41282725-41282747 TCCCATAGAAATTACCCTAGGGG No data
1189466656_1189466660 25 Left 1189466656 X:41282675-41282697 CCACTGATAAAAATTTCAAAAGT No data
Right 1189466660 X:41282723-41282745 AGTCCCATAGAAATTACCCTAGG No data
1189466656_1189466661 26 Left 1189466656 X:41282675-41282697 CCACTGATAAAAATTTCAAAAGT No data
Right 1189466661 X:41282724-41282746 GTCCCATAGAAATTACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189466656 Original CRISPR ACTTTTGAAATTTTTATCAG TGG (reversed) Intergenic
No off target data available for this crispr