ID: 1189466659

View in Genome Browser
Species Human (GRCh38)
Location X:41282705-41282727
Sequence GGACTCCTAACAACATAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189466659_1189466669 21 Left 1189466659 X:41282705-41282727 CCAATCTATGTTGTTAGGAGTCC No data
Right 1189466669 X:41282749-41282771 ACAAGGCGCTTCTGGAGTGCTGG No data
1189466659_1189466665 4 Left 1189466659 X:41282705-41282727 CCAATCTATGTTGTTAGGAGTCC No data
Right 1189466665 X:41282732-41282754 GAAATTACCCTAGGGGCACAAGG No data
1189466659_1189466668 13 Left 1189466659 X:41282705-41282727 CCAATCTATGTTGTTAGGAGTCC No data
Right 1189466668 X:41282741-41282763 CTAGGGGCACAAGGCGCTTCTGG No data
1189466659_1189466662 -3 Left 1189466659 X:41282705-41282727 CCAATCTATGTTGTTAGGAGTCC No data
Right 1189466662 X:41282725-41282747 TCCCATAGAAATTACCCTAGGGG No data
1189466659_1189466661 -4 Left 1189466659 X:41282705-41282727 CCAATCTATGTTGTTAGGAGTCC No data
Right 1189466661 X:41282724-41282746 GTCCCATAGAAATTACCCTAGGG No data
1189466659_1189466660 -5 Left 1189466659 X:41282705-41282727 CCAATCTATGTTGTTAGGAGTCC No data
Right 1189466660 X:41282723-41282745 AGTCCCATAGAAATTACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189466659 Original CRISPR GGACTCCTAACAACATAGAT TGG (reversed) Intergenic
No off target data available for this crispr