ID: 1189466661

View in Genome Browser
Species Human (GRCh38)
Location X:41282724-41282746
Sequence GTCCCATAGAAATTACCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189466656_1189466661 26 Left 1189466656 X:41282675-41282697 CCACTGATAAAAATTTCAAAAGT No data
Right 1189466661 X:41282724-41282746 GTCCCATAGAAATTACCCTAGGG No data
1189466659_1189466661 -4 Left 1189466659 X:41282705-41282727 CCAATCTATGTTGTTAGGAGTCC No data
Right 1189466661 X:41282724-41282746 GTCCCATAGAAATTACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189466661 Original CRISPR GTCCCATAGAAATTACCCTA GGG Intergenic
No off target data available for this crispr