ID: 1189470861

View in Genome Browser
Species Human (GRCh38)
Location X:41313022-41313044
Sequence AGCTACTTGTAGCAGTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189470855_1189470861 27 Left 1189470855 X:41312972-41312994 CCACGAGCTCTTGAGTGAGGTTC No data
Right 1189470861 X:41313022-41313044 AGCTACTTGTAGCAGTCTGGTGG No data
1189470859_1189470861 -10 Left 1189470859 X:41313009-41313031 CCAAGGTAACATTAGCTACTTGT No data
Right 1189470861 X:41313022-41313044 AGCTACTTGTAGCAGTCTGGTGG No data
1189470858_1189470861 2 Left 1189470858 X:41312997-41313019 CCTGGAAAGTAACCAAGGTAACA No data
Right 1189470861 X:41313022-41313044 AGCTACTTGTAGCAGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189470861 Original CRISPR AGCTACTTGTAGCAGTCTGG TGG Intergenic
No off target data available for this crispr