ID: 1189471142

View in Genome Browser
Species Human (GRCh38)
Location X:41315217-41315239
Sequence CCAGAGGCAATAATGGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189471136_1189471142 0 Left 1189471136 X:41315194-41315216 CCCAGCAGCACTGGGCTGTGGGG No data
Right 1189471142 X:41315217-41315239 CCAGAGGCAATAATGGCAACAGG No data
1189471132_1189471142 5 Left 1189471132 X:41315189-41315211 CCTTCCCCAGCAGCACTGGGCTG No data
Right 1189471142 X:41315217-41315239 CCAGAGGCAATAATGGCAACAGG No data
1189471134_1189471142 1 Left 1189471134 X:41315193-41315215 CCCCAGCAGCACTGGGCTGTGGG No data
Right 1189471142 X:41315217-41315239 CCAGAGGCAATAATGGCAACAGG No data
1189471138_1189471142 -1 Left 1189471138 X:41315195-41315217 CCAGCAGCACTGGGCTGTGGGGC No data
Right 1189471142 X:41315217-41315239 CCAGAGGCAATAATGGCAACAGG No data
1189471128_1189471142 17 Left 1189471128 X:41315177-41315199 CCTCATTCCAGTCCTTCCCCAGC No data
Right 1189471142 X:41315217-41315239 CCAGAGGCAATAATGGCAACAGG No data
1189471129_1189471142 10 Left 1189471129 X:41315184-41315206 CCAGTCCTTCCCCAGCAGCACTG No data
Right 1189471142 X:41315217-41315239 CCAGAGGCAATAATGGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189471142 Original CRISPR CCAGAGGCAATAATGGCAAC AGG Intergenic
No off target data available for this crispr