ID: 1189473835

View in Genome Browser
Species Human (GRCh38)
Location X:41334243-41334265
Sequence CTCTTCAGGGATGAGTCATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 4, 1: 0, 2: 0, 3: 13, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189473832_1189473835 -9 Left 1189473832 X:41334229-41334251 CCGAGTTCTCGGTACTCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG 0: 4
1: 0
2: 0
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189473835 Original CRISPR CTCTTCAGGGATGAGTCATG TGG Exonic
904397363 1:30230890-30230912 AGCTTCAGGGCTGAGTCAGGGGG - Intergenic
905268640 1:36772064-36772086 ATCTTCAGGGAGGGCTCATGAGG + Intergenic
908469466 1:64429390-64429412 ATCTACAGGGACCAGTCATGTGG - Intergenic
908512620 1:64861445-64861467 CTCTTCAGGGATCAATGATCAGG - Intronic
915599575 1:156913846-156913868 CTCTTCAGAGATGAGCCCTAAGG - Exonic
915971067 1:160355705-160355727 CTCTTCAGGGCTCAGCCATTCGG - Exonic
917973690 1:180225103-180225125 CTCTGCGGGGATGAGTAATACGG + Intergenic
922007604 1:221547903-221547925 ACCATCAGGGATGAGGCATGTGG + Intergenic
1064324972 10:14341011-14341033 TTCTTGAGGCAGGAGTCATGGGG - Intronic
1067221064 10:44344822-44344844 CTCTTTAAGGAAGATTCATGAGG + Intergenic
1068521724 10:58084516-58084538 CTCTTCAGGGGTCAGTTAGGTGG - Intergenic
1070259706 10:74843218-74843240 TTCTTCAGGGAGGAGCCATTCGG - Exonic
1070533836 10:77360765-77360787 CTCTTCTGGGCTGAGTGCTGTGG - Intronic
1071957904 10:90779145-90779167 TTCTTCAGGGATGGCTCCTGGGG - Intronic
1072764277 10:98083280-98083302 GACTTCAGGAATGAGCCATGGGG + Intergenic
1075374541 10:121967874-121967896 CTCTTAAAGGTTGAGTGATGCGG - Intronic
1075424801 10:122333186-122333208 CTCTCCAGGGATGACTCAGAGGG - Intronic
1076451683 10:130560947-130560969 CTCTTGTGGGGTGAGTCCTGAGG - Intergenic
1077024703 11:433936-433958 GTCTGCAGGGAGGAGGCATGGGG + Exonic
1083763967 11:64833376-64833398 CCCCTCAGGGATGGGGCATGGGG - Intronic
1085041499 11:73328969-73328991 CTGTTCAGAGATGAGACGTGAGG + Intronic
1085340918 11:75731045-75731067 TTCTGCAGGGATGAACCATGGGG + Intronic
1087375597 11:97335975-97335997 CTCTTCAAAGAGGAGTCAAGTGG - Intergenic
1090722307 11:129487807-129487829 CTCTGCAAGGATGAGTCACTTGG - Intergenic
1092037103 12:5345734-5345756 TTCTTCTGTGATGAGTCATCAGG + Intergenic
1095999549 12:48117751-48117773 CTCCTGAGGGCTGTGTCATGGGG - Intronic
1099202795 12:79694525-79694547 CTGTTCATAGCTGAGTCATGTGG + Intergenic
1101671660 12:106880953-106880975 CTCTTCATGGTTTAGTCATTAGG + Intronic
1102354809 12:112223858-112223880 CTCTTCTGGGATGAATTAAGTGG - Intronic
1102616170 12:114156219-114156241 CACTTCAGGGATGTGTAAAGAGG + Intergenic
1103730558 12:123024871-123024893 CTTTAAATGGATGAGTCATGTGG + Intronic
1104837521 12:131801037-131801059 TTCTTCAGTGATGAGTCAAATGG + Intergenic
1105642442 13:22279584-22279606 TTCTTCAGGGATGAGGCAGGTGG + Intergenic
1107929147 13:45292415-45292437 GTGTTCAGGGATGAGTCAACAGG - Intergenic
1111823011 13:93236033-93236055 CTCATCAAGGAAGAGACATGTGG - Intronic
1113031091 13:105994462-105994484 CTGTTGAGGGATAAGACATGTGG - Intergenic
1114595667 14:23909648-23909670 CTCTTTATGGATCACTCATGTGG + Intergenic
1118048800 14:62003979-62004001 ATTTTCAGGGATGGATCATGAGG + Intronic
1202861475 14_GL000225v1_random:85291-85313 CTCTGCACTGATCAGTCATGTGG + Intergenic
1124174149 15:27406442-27406464 CTCACCAGTGATGAGCCATGTGG + Intronic
1125602772 15:40924588-40924610 CTCATAAGGGATGAGGCATGAGG - Intergenic
1129084872 15:73078428-73078450 GTCTTCAAGGATGATTCAGGAGG + Intronic
1130186640 15:81689747-81689769 CTCATCTGGGATTAGTCATTTGG + Intergenic
1131843934 15:96468961-96468983 CTCTTCAGGGATAACTGCTGGGG - Intergenic
1134263871 16:12676036-12676058 CTCTTCCTGAATGAGTCAGGTGG - Intronic
1134368184 16:13598699-13598721 CTCCTGAGGGCTGTGTCATGGGG - Intergenic
1134378519 16:13702208-13702230 CTCTTAAGGGTTTAGTTATGAGG + Intergenic
1138199826 16:55080433-55080455 CTCTGCAGGGATGAGGGTTGAGG + Intergenic
1144409658 17:14988344-14988366 CACTTCAAGGATGACTCAGGAGG + Intergenic
1149543653 17:57487460-57487482 CACTTGATGGATGAGTGATGAGG - Intronic
1150077500 17:62205193-62205215 CTCTTCAGGGAGGAACCATAGGG + Intergenic
1203169213 17_GL000205v2_random:132027-132049 CTATTCAGGGTTCAGTCTTGTGG - Intergenic
1203174382 17_GL000205v2_random:183038-183060 CTATTCAGGGTTCAGTCTTGTGG + Intergenic
1155596290 18:27491924-27491946 CACTTCAGGGGTGAGTGAAGGGG - Intergenic
1156490510 18:37493214-37493236 CTCTAAAGGGGTGAGGCATGGGG - Intronic
1156775837 18:40787502-40787524 CTCTGCAGTGATGGGTCATAGGG + Intergenic
1157157338 18:45280799-45280821 CTCTTCAGAGATGATTCAAGAGG - Intronic
1160501971 18:79406104-79406126 CAGTTCAGGGCTGAGTCCTGTGG + Intronic
1163517730 19:17775071-17775093 CGATTCAGGGGTGAGTGATGTGG + Exonic
1165159927 19:33810092-33810114 TTCCTCAGGCATGAGTCATGGGG + Intronic
1166702937 19:44892533-44892555 CTCTTGAGGGAGGAGTAATTGGG - Intronic
1166945210 19:46391982-46392004 TTCTTCAGGGGTTGGTCATGGGG + Intronic
925268135 2:2581603-2581625 CTCTTGAGGGATGAGCCCCGAGG - Intergenic
925667326 2:6273333-6273355 CTCTTCACCGCTGAGCCATGTGG + Intergenic
926352715 2:12011431-12011453 CCCTTCAGGGATGAGTAATCTGG - Intergenic
933863318 2:86492162-86492184 CTCTTCAGGCAGGATTCCTGTGG + Exonic
946226384 2:218266133-218266155 CTCTTCAGGGAAGAGAGCTGTGG - Exonic
946362678 2:219228818-219228840 CTCTTCAGGAAAGACTCTTGAGG - Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
948827596 2:240580295-240580317 CTCAACTGGGATGACTCATGAGG - Exonic
1168970007 20:1924572-1924594 CTGTTCATGGATGAGTCTCGTGG + Intronic
1169939829 20:10925104-10925126 CTCTTCAAAGCTGAGCCATGTGG - Intergenic
1169945347 20:10982457-10982479 CTCTTTAGAGATGTGTAATGTGG - Intergenic
1171128127 20:22622864-22622886 TTCTTCAGGAAAGAGACATGAGG + Intergenic
1171445299 20:25198563-25198585 CACTCCAGGGATGAATAATGAGG - Intronic
1173143149 20:40502445-40502467 CTCTTTAGGGATGAGAGAGGTGG + Intergenic
1173790700 20:45826069-45826091 CTTTTCAGGGATGAGATATCAGG + Intronic
1173978747 20:47206943-47206965 ATCTTCAGATTTGAGTCATGTGG + Intergenic
1175150939 20:56933729-56933751 GTGTTCAGGGATGAGTTATAGGG - Intergenic
1175685479 20:61024956-61024978 ATCTTCGGGGATGATCCATGTGG - Intergenic
1175731741 20:61358848-61358870 CTCTACAGGGAGCCGTCATGCGG + Intronic
1176048944 20:63106462-63106484 CTCTTGAGGCTTGAGACATGGGG - Intergenic
1176402544 21:6327126-6327148 CTATTCAGGGTTCAGTCTTGTGG + Intergenic
1176434613 21:6661978-6662000 CTATTCAGGGTTCAGTCTTGTGG - Intergenic
1176458875 21:6989048-6989070 CTATTCAGGGTTCAGTCTTGTGG - Intergenic
1177278329 21:18945577-18945599 CCCTTCATGGATGAGCCATGTGG - Intergenic
1177928706 21:27251718-27251740 TACTTCAGGGATGAGTGAGGAGG - Intergenic
1178773677 21:35528806-35528828 ATCTCCAGGAATCAGTCATGGGG + Intronic
1179972839 21:44845866-44845888 CTCTGCGGGGAGGAGTCCTGGGG - Intergenic
1180393737 22:12309808-12309830 CACTTTAGTGCTGAGTCATGTGG + Intergenic
1180406009 22:12554940-12554962 CACTTTAGTGCTGAGTCATGTGG - Intergenic
1181022987 22:20113220-20113242 CTCTTCAGAGTTGAGTAATGTGG - Exonic
1181406997 22:22692177-22692199 CTCTTCATGGCTGAGTTAAGTGG + Intergenic
1183267442 22:36837767-36837789 CTCTGCAGAAATGAGTGATGGGG + Intergenic
1183704878 22:39470193-39470215 CTCTGCAGGGATGAGCGCTGGGG + Intronic
1185231924 22:49688451-49688473 CTCTGCACGGATGGGTCCTGGGG - Intergenic
949296522 3:2530997-2531019 ATCTTCATAGATGACTCATGTGG + Intronic
952845020 3:37681052-37681074 CTCTTCACGGATGGGTAATGAGG + Intronic
955229396 3:57085464-57085486 TCCTATAGGGATGAGTCATGGGG - Intergenic
961220721 3:125197533-125197555 CTCTGCAGGGCTGAGACAGGAGG - Intronic
962851714 3:139313096-139313118 CCCTTCAGGGCTGAGTCCTTAGG + Intronic
964156753 3:153594932-153594954 CTTTTCATGTATGAATCATGTGG - Intergenic
966635135 3:182124469-182124491 CTCTGCTGGGATGTGACATGAGG - Intergenic
970748047 4:19323405-19323427 TCCTTCTGGGCTGAGTCATGTGG + Intergenic
971068346 4:23060917-23060939 ATTGACAGGGATGAGTCATGAGG - Intergenic
971386919 4:26149295-26149317 CTCTTCAGTGATTTGTCAAGTGG + Intergenic
973076301 4:45931343-45931365 CAGTTCTGGCATGAGTCATGTGG + Intergenic
976764068 4:88580651-88580673 GTCTTCAGGAAGGAGTCATTAGG + Intronic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
979620498 4:122793718-122793740 CTCTGCCATGATGAGTCATGGGG - Intergenic
981292814 4:143096143-143096165 CTCCTGAGGGCTGTGTCATGTGG + Intergenic
984746857 4:183229551-183229573 ATCACCAGGGATGAGTCATGTGG + Intronic
984866349 4:184283882-184283904 CTCTTCAGGGCTGAGACACGTGG - Intergenic
988997340 5:36727064-36727086 CTCTTGAAGGATCAGTAATGTGG + Intergenic
990246388 5:53867438-53867460 CTTTTCAGGAAAGAGTCATTTGG + Intergenic
991448839 5:66730244-66730266 CTCTTCAGGGAGGAGATTTGGGG - Intronic
998059331 5:139107025-139107047 CTCTGCAGGGCTGAGTGATCAGG - Intronic
1001232188 5:169998076-169998098 ATCCTCAGGGAGGAGTCAGGAGG - Intronic
1001377012 5:171269577-171269599 CTCTTCAGGGCTGATTTATAAGG - Intronic
1007868209 6:44999539-44999561 CTCTTCAGGGAAGAGAGAAGAGG - Intronic
1012975787 6:105779759-105779781 CTGTTCAGGAATAAGTCAGGTGG - Intergenic
1016086246 6:139918975-139918997 ATCTTCAGAGATGGGTCATTTGG + Intergenic
1016539417 6:145147574-145147596 CTCTTCAGGGACTAGACATAAGG - Intergenic
1016964957 6:149710228-149710250 CTCCTGAGGGCTGTGTCATGGGG + Intronic
1021634354 7:22676904-22676926 CTATTCAGAGCTGAGTCATGGGG + Intergenic
1024157358 7:46638910-46638932 CTCTTAAGGGATAAGTAGTGGGG + Intergenic
1026039953 7:66859882-66859904 CTGTTCAGGGCGGAGTCAGGAGG - Intergenic
1026487718 7:70835836-70835858 TTCTTCAGGGAAGGGTCATTTGG - Intergenic
1027264259 7:76485378-76485400 CTCTTGAGGGATGAGCTAGGAGG + Intronic
1027315629 7:76983492-76983514 CTCTTGAGGGATGAGCTAGGAGG + Intergenic
1030480111 7:110092664-110092686 CTTCTCAGGGATCAGTCCTGTGG - Intergenic
1032797923 7:135292348-135292370 CTCTACAGGAATGAGGTATGAGG + Intergenic
1033096721 7:138438703-138438725 TTCTTCAGGGATGGGGAATGGGG + Intergenic
1033436302 7:141336384-141336406 CTTTTCAGAGATCAGTCAGGAGG + Intronic
1034522815 7:151633043-151633065 CTCTGCAGGGATGGGCCGTGGGG - Intronic
1037418795 8:18679634-18679656 CATTTTAGGGATGAGTCTTGGGG + Intronic
1037656250 8:20886804-20886826 CTCTTCAGGGCTGGGACATGGGG - Intergenic
1040841446 8:51789415-51789437 GTCTTCAGGGATGAACAATGAGG + Intronic
1042669134 8:71241752-71241774 CTCATCAGGGAGAAGTGATGTGG - Intronic
1042672883 8:71283629-71283651 CTCTTGAGGGATGTGTCACAGGG + Intronic
1046777482 8:118179475-118179497 GTCTTCAGGGATGCTTAATGTGG + Intergenic
1048871505 8:138803072-138803094 CTCTCCAGGGGTGGGACATGTGG - Intronic
1050141898 9:2524835-2524857 CTGTTCAGTGATGAGAAATGAGG - Intergenic
1051706833 9:19889545-19889567 CTTTTCAGGGGTGAGGGATGGGG + Intergenic
1056839386 9:89986293-89986315 ATTTTCTGGGATGATTCATGTGG - Intergenic
1057818281 9:98311732-98311754 CTGGCCAAGGATGAGTCATGTGG - Intronic
1061460074 9:130730409-130730431 CTCTTCTTTGATGACTCATGAGG + Intronic
1061998826 9:134205504-134205526 CTCTGCAGGGATGCTTGATGGGG + Intergenic
1203429381 Un_GL000195v1:76645-76667 CTATTCAGGGTTCAGTCTTGTGG - Intergenic
1203436921 Un_GL000195v1:146667-146689 CTATTCAGGGTTCAGTCTTGTGG + Intergenic
1185464613 X:346940-346962 CCCGTGAGGGATGAGGCATGTGG + Intronic
1185464636 X:347050-347072 CCCATGAGGGATGAGGCATGTGG + Intronic
1187442586 X:19333289-19333311 CCCTTCTGGGATGAATCCTGTGG + Intergenic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1193241094 X:79170520-79170542 CTCTTCAGGGATGATTAACTTGG - Intergenic
1195004886 X:100676162-100676184 CTCCTCAGGGATCAGTAATGGGG - Exonic
1196354512 X:114774837-114774859 CTCTTCAGTGATGGGCCTTGAGG + Intronic
1198016551 X:132617124-132617146 CACTCCAGGTATGAGCCATGAGG - Intergenic
1198275729 X:135095951-135095973 CTCTTCTGGGGTGAGGCAGGCGG + Intergenic
1201323398 Y:12726977-12726999 CTGTTCAGGCATGAGTTATATGG - Intronic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic
1201534270 Y:15028534-15028556 CTCTCCAGCAATGAATCATGAGG - Intergenic