ID: 1189475368

View in Genome Browser
Species Human (GRCh38)
Location X:41349378-41349400
Sequence GAACGCAGCTTGTCTAGGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189475365_1189475368 7 Left 1189475365 X:41349348-41349370 CCAATCTTACTTTGTCTCTTGGA 0: 2
1: 2
2: 1
3: 22
4: 263
Right 1189475368 X:41349378-41349400 GAACGCAGCTTGTCTAGGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 91
1189475363_1189475368 17 Left 1189475363 X:41349338-41349360 CCTTAAACTTCCAATCTTACTTT 0: 2
1: 2
2: 2
3: 16
4: 309
Right 1189475368 X:41349378-41349400 GAACGCAGCTTGTCTAGGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189475368 Original CRISPR GAACGCAGCTTGTCTAGGAA GGG Exonic
902689400 1:18100687-18100709 TATTGCAGCTTGTCCAGGAAAGG + Intergenic
904544955 1:31262222-31262244 GAAATCAGCTTGTCTAGGCTGGG + Intronic
911701768 1:100961357-100961379 GAACTCAGCTCCTCTAGGGATGG - Intronic
918298288 1:183178633-183178655 GAACTCAGCTTTTCTAGGGCTGG - Intergenic
921378554 1:214500332-214500354 GATTGCAGCTTATTTAGGAAGGG - Intronic
923569486 1:235101226-235101248 GAATGAAGATTGTCTATGAAAGG + Intergenic
1064004474 10:11689085-11689107 GGACGCAGCTTCTCCAGCAAAGG - Intergenic
1064601408 10:16997447-16997469 AAAGGCAGCTTGTGGAGGAAGGG + Intronic
1068801240 10:61142794-61142816 GAATACAGTTTGTGTAGGAAAGG + Intergenic
1070156448 10:73838581-73838603 GAACACAGCTTGGGGAGGAATGG - Intronic
1074803217 10:117023345-117023367 GAATGCAGCTCATCTAGGAAGGG - Intronic
1076181502 10:128412519-128412541 GAAAGCAGCCAGTCAAGGAAAGG - Intergenic
1080007755 11:27427843-27427865 AAACGCAGCTATTCTTGGAATGG - Intronic
1082907201 11:58321376-58321398 CATCACAGTTTGTCTAGGAAAGG - Intergenic
1083305815 11:61761458-61761480 GATCGCAGCCTGCCTGGGAAGGG + Intronic
1086276487 11:85135591-85135613 AAACACAGCTTGTCTAGCATAGG + Intronic
1087065905 11:94027745-94027767 GAACACACCTTGTATATGAAGGG + Intronic
1087128498 11:94649271-94649293 GAAGGAAGCTCATCTAGGAAAGG + Intergenic
1087150639 11:94856525-94856547 GAACTCAGCCTGTCCGGGAAAGG + Intronic
1088244935 11:107808669-107808691 CAACGCATCATGTGTAGGAATGG + Intronic
1089136966 11:116256947-116256969 GAATTCAGCTTGGCTAGGAGTGG + Intergenic
1089637368 11:119823994-119824016 GAACTCAGATTGGCAAGGAAAGG - Intergenic
1092363939 12:7861467-7861489 AAAAGCAGGTTTTCTAGGAACGG + Intronic
1092380662 12:7994233-7994255 AAAAGCAGGTTTTCTAGGAATGG - Intergenic
1100333433 12:93607225-93607247 GATGGCAGATTTTCTAGGAATGG + Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1110649010 13:77920882-77920904 CAACAAAGCTTGTATAGGAAGGG - Intergenic
1114298331 14:21350769-21350791 GAACATAGCATGTTTAGGAATGG - Intronic
1125512782 15:40301884-40301906 GAAAGCAACTTGGCCAGGAATGG - Intronic
1127385423 15:58462841-58462863 GAGCTCAGCTGGTCTTGGAAAGG - Intronic
1128562400 15:68677499-68677521 GGAGGCAGCTTTTCTGGGAAAGG + Intronic
1128911084 15:71515660-71515682 AAATGCAGCTTGTGTGGGAAAGG + Intronic
1133102639 16:3488466-3488488 GAACGCCGGTGGGCTAGGAATGG - Intergenic
1133967588 16:10542811-10542833 CTACACAGCTTGTCTAGGAACGG + Intronic
1135840436 16:25871237-25871259 GAAGGCAGGTTTTGTAGGAAGGG + Intronic
1140274696 16:73498106-73498128 GAAGGCAGCATGCCTAAGAAAGG - Intergenic
1142121895 16:88390550-88390572 AAAGTCAGCTTGCCTAGGAAGGG - Intergenic
1145981004 17:29011525-29011547 CAAGGCAGCTTGGCTTGGAAAGG + Intronic
1149661663 17:58337355-58337377 GAAGGCAGGGTGGCTAGGAATGG + Intergenic
1153127983 18:1818747-1818769 GGAAGAAGCTTGTCTAGCAAAGG - Intergenic
1153601341 18:6783811-6783833 GAACGCAGTTTTCCTAGGGATGG - Intronic
1156030011 18:32701745-32701767 GATAGCAGCTTGGCTAGGAGGGG + Intronic
1156832830 18:41515469-41515491 GAACAGAGCCTGACTAGGAAGGG + Intergenic
1156894248 18:42227058-42227080 TAACACAGTTTGTATAGGAAAGG + Intergenic
1158996811 18:62929655-62929677 TAACGCAGCTTGACTGGGAGTGG + Intronic
1164550560 19:29208038-29208060 GAAAGCAGCGAGGCTAGGAAAGG - Exonic
925824157 2:7830841-7830863 AAACGCAGATTTTCAAGGAATGG - Intergenic
927835022 2:26389058-26389080 AAACTCAGATTGACTAGGAATGG + Exonic
928262146 2:29777714-29777736 GAACTCAGAATGTCTAGGATGGG + Intronic
928705553 2:33946078-33946100 GAACGAAGGTAGTCTAGGAAGGG + Intergenic
930210351 2:48630330-48630352 GAACGCATCTACTCAAGGAAGGG - Intronic
938084663 2:128390884-128390906 GAATGCAGTTTATCTTGGAAAGG + Intergenic
939192113 2:138929260-138929282 GAAATCTGCTTGTCAAGGAAGGG - Intergenic
939543651 2:143525080-143525102 GAGCAGAGCTTGTCTAGGGAAGG - Intronic
940071708 2:149695940-149695962 GAACAAAGCCTGTCTGGGAACGG + Intergenic
940141580 2:150497147-150497169 GAAGACAGTTTGACTAGGAAGGG - Intronic
940907748 2:159184271-159184293 GAATGCAGATTGTCTTAGAAGGG + Intronic
947864851 2:233389530-233389552 CAAAGCAGCTTGTTTAGAAAGGG + Intronic
1174305490 20:49611610-49611632 GAATGGAGCGTGTCTAGGACAGG - Intergenic
1176029645 20:63005775-63005797 GGACCCAGCAAGTCTAGGAACGG - Intergenic
1176091967 20:63322207-63322229 GCACGCAGCTTCCCTAGGCAGGG + Intronic
1181379662 22:22491400-22491422 GAATGCAGCCTGTGTAGTAAAGG - Intronic
1182216399 22:28722129-28722151 GCACACAGCTTGTCAAGGAGAGG + Intronic
1182692732 22:32175400-32175422 GAAAGCTGCTTGTCCAGTAAAGG + Intergenic
1182803496 22:33051339-33051361 GATCGCAGTGTGTCTATGAAAGG + Intronic
958686677 3:97407654-97407676 GAATACAGCTTGACTATGAAAGG + Intronic
959516609 3:107274212-107274234 GAAGGCTGCTTTTCTAGCAAGGG - Intergenic
959558726 3:107754294-107754316 GAATTCAGCATGTCTAGAAAAGG + Intronic
961066769 3:123883148-123883170 GAACACAGCCTCTCTTGGAAGGG + Intronic
963220872 3:142810809-142810831 AAACACAGCTTGTTTATGAATGG - Intergenic
964935732 3:162083996-162084018 GAACATAGTTTATCTAGGAATGG + Intergenic
978002695 4:103575715-103575737 GAACACAGCTTGTCTGGGAAGGG + Intergenic
979524907 4:121706491-121706513 GAAGGCATCTTGTCTGAGAAAGG + Intergenic
982197970 4:152935512-152935534 GAACGCACGCTGTCTGGGAAAGG - Intergenic
992228938 5:74644303-74644325 GAATGCAGCTTGCCCAGGGAAGG + Intronic
992416843 5:76559884-76559906 GAACGCATCTTGTCCAGGGTTGG + Intronic
993000736 5:82378250-82378272 GAACTCCGCTTCTTTAGGAAGGG - Intronic
995942952 5:117607352-117607374 GAATGCAGCATTTCTGGGAAAGG + Intergenic
998534777 5:142919486-142919508 GAACGCAGTTTGAATAGGGAGGG + Intronic
1003147262 6:3518815-3518837 GAACGCAGCCTGGCTCAGAAAGG - Intergenic
1003221510 6:4164838-4164860 GAACGCAGTTTAGGTAGGAAAGG + Intergenic
1005019738 6:21406296-21406318 AAACGCATCTTGTCGGGGAAGGG + Intergenic
1011464936 6:87645318-87645340 GTTGGCAGCTTCTCTAGGAAGGG + Intronic
1011657011 6:89561138-89561160 GTAAGCAGCTTTTCTTGGAAGGG + Intronic
1030286038 7:107827621-107827643 GAACGCAGCATGTTTAGGCAGGG - Intergenic
1030693548 7:112559608-112559630 GCACCCATCTTGTATAGGAATGG - Intergenic
1032490148 7:132318352-132318374 GAACCCAGAGTGTCGAGGAAAGG + Intronic
1037916083 8:22774333-22774355 AAACGCAGCTGCTCTAGGAAAGG - Intronic
1037930626 8:22878085-22878107 AAACTCAGCTTGGCTGGGAAAGG + Intronic
1038378248 8:27064781-27064803 TAACACAGCTTTTCTAGGAAGGG - Intergenic
1045907331 8:107362857-107362879 TTACCCAGCTTGTCTAGGATTGG + Intronic
1051538974 9:18193284-18193306 GAATGCAAGTTGACTAGGAATGG + Intergenic
1051997232 9:23232857-23232879 GAACGCTGGTTGCCTGGGAAGGG + Intergenic
1186307086 X:8273452-8273474 CATTGCAGCCTGTCTAGGAAGGG + Intergenic
1186423127 X:9442780-9442802 AAACGGATCTTGTCTAAGAAGGG - Intergenic
1188191934 X:27182336-27182358 GAAAGAAGCTTGGCTAGCAAAGG + Intergenic
1189475368 X:41349378-41349400 GAACGCAGCTTGTCTAGGAAGGG + Exonic
1189687421 X:43579649-43579671 GAACGCAGCTTTATGAGGAAGGG + Intergenic
1200218154 X:154377992-154378014 GAGCGCAGCGTGGCTAGGCAGGG - Intergenic