ID: 1189475537

View in Genome Browser
Species Human (GRCh38)
Location X:41352149-41352171
Sequence GGATGTGGCTGTTCACCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189475537_1189475542 3 Left 1189475537 X:41352149-41352171 CCTCTAGGTGAACAGCCACATCC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1189475542 X:41352175-41352197 ATTTCCTCCCCCCTCTTCAAAGG 0: 1
1: 0
2: 2
3: 19
4: 239
1189475537_1189475543 4 Left 1189475537 X:41352149-41352171 CCTCTAGGTGAACAGCCACATCC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1189475543 X:41352176-41352198 TTTCCTCCCCCCTCTTCAAAGGG 0: 1
1: 0
2: 4
3: 40
4: 341
1189475537_1189475551 16 Left 1189475537 X:41352149-41352171 CCTCTAGGTGAACAGCCACATCC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1189475551 X:41352188-41352210 TCTTCAAAGGGTCATTAGGTAGG 0: 1
1: 0
2: 1
3: 15
4: 120
1189475537_1189475548 12 Left 1189475537 X:41352149-41352171 CCTCTAGGTGAACAGCCACATCC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1189475548 X:41352184-41352206 CCCCTCTTCAAAGGGTCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189475537 Original CRISPR GGATGTGGCTGTTCACCTAG AGG (reversed) Intronic
902377402 1:16036344-16036366 GGATCTCGCTGTTCCCCCAGGGG - Intergenic
902382579 1:16059602-16059624 GGATCTCGCTGTTCCCCCAGGGG - Exonic
902809773 1:18881606-18881628 GGATGGGGCTGTGAACCCAGGGG - Intronic
902876256 1:19342605-19342627 GAATGTGGCTGTGCACCGACCGG + Intronic
909961058 1:81842980-81843002 GGATTTGGCTGTAAACCTAATGG + Intronic
910024376 1:82631234-82631256 GGATGTTTCTGATCACCTTGAGG + Intergenic
915527421 1:156484690-156484712 GCATGGAGCTGTTCAACTAGTGG - Intronic
916562287 1:165943444-165943466 GGATGTTTCTGGCCACCTAGAGG - Intergenic
918223535 1:182457564-182457586 GTGTGAGGCTGTTCATCTAGGGG + Intronic
1063984900 10:11491803-11491825 GGTTGTGGTTCTTTACCTAGAGG - Intronic
1076844586 10:133063053-133063075 GGGTGTGTGTGTTCACCCAGCGG - Intergenic
1076844811 10:133064747-133064769 GGGTGTGTGTGTTCACCCAGCGG - Intergenic
1076844834 10:133064910-133064932 GGATGTGTGTGTTCACCCAGCGG - Intergenic
1076844846 10:133064992-133065014 GCATGTGTGTGTTCACCCAGCGG - Intergenic
1083767976 11:64851256-64851278 AGATGTGGCCGCCCACCTAGAGG - Intergenic
1088758602 11:112908072-112908094 GGATTTGCCTGTTTACCTGGAGG + Intergenic
1090449465 11:126793414-126793436 GGATGTGCATGCTCAGCTAGAGG + Intronic
1090950918 11:131472516-131472538 GGATGTGGCTGTTAAAGGAGGGG + Intronic
1091453515 12:588105-588127 TGATTTGGCTTTTCACATAGTGG - Intronic
1092013527 12:5137572-5137594 GGACTTGGCTGGGCACCTAGAGG - Intergenic
1094240308 12:28214427-28214449 GGTTGTGACTGTTTACCCAGTGG - Intronic
1095825350 12:46525034-46525056 GGAGGTGGCTGTTTGCCTGGCGG + Intergenic
1097758422 12:63433292-63433314 GGAAATGGCTGTTCAGCCAGTGG - Intergenic
1098562380 12:71889225-71889247 GGATGTGGCTGCTCTTCTTGGGG + Intronic
1100544870 12:95591893-95591915 GGCTGTGGGTCTTCAGCTAGTGG - Intergenic
1103520048 12:121532248-121532270 AGATGTGGCTGATGACCTAGGGG - Intronic
1104615618 12:130265791-130265813 GAATATGGCTCTTCACCCAGAGG - Intergenic
1107044992 13:35984486-35984508 GGATGGGGCTGTTGAGCTGGAGG + Intronic
1114933667 14:27506869-27506891 GGAGGTTGCTGTGGACCTAGGGG + Intergenic
1118877386 14:69796851-69796873 GTCTGTGGCTGCTCACCTGGAGG - Exonic
1118900192 14:69979984-69980006 GGATGTGGCTTTGCACCCTGTGG + Intronic
1119227710 14:72956695-72956717 GGATGAGGCTGTCCACCTGGTGG - Intronic
1122269503 14:100562236-100562258 GGATGGGGCTGGCCACCTGGCGG - Intronic
1127274645 15:57431570-57431592 GGATGTGTCTGTGGAACTAGTGG - Intronic
1128665852 15:69538008-69538030 GGATGGGGCTGAGCTCCTAGGGG - Intergenic
1129205380 15:74034401-74034423 GGGTGTGGGTGTGCACCTATGGG - Intronic
1129389006 15:75211207-75211229 GGCTGTGGCTGCTCCCCTGGAGG + Exonic
1129710121 15:77816625-77816647 GGAAGTGGCTGTTTTCCTAAAGG + Intronic
1130065897 15:80604783-80604805 GGTTGTGGCTGTAGAACTAGAGG - Intergenic
1132897326 16:2235209-2235231 TGATGTGGCTGTCCACCTGCAGG - Exonic
1138134348 16:54508671-54508693 AAATGTGACTGATCACCTAGGGG - Intergenic
1145974040 17:28974047-28974069 AGATGAGGCTGTTGAGCTAGAGG - Intronic
1152013159 17:77733168-77733190 TGATGTGGCTGTTCCACCAGGGG - Intergenic
1152535923 17:80950322-80950344 GGATGTGGCCTTACACCTCGTGG + Intronic
1153514651 18:5892130-5892152 GGAGGTGGCTGAGCAGCTAGTGG - Exonic
1153709975 18:7788691-7788713 GCATGTGACTATTCACCTATGGG - Intronic
1156867383 18:41904096-41904118 GGGTGGGGGTGTTCACCCAGGGG - Intergenic
1160594366 18:79964019-79964041 GGTTGTGGCTCGTCACCTTGTGG - Intergenic
1162737625 19:12755280-12755302 GGAGGTGGGTGGTCACCTGGTGG - Intronic
1165262636 19:34634022-34634044 TGTTGTGGCTGTTCACCTCTAGG - Intronic
1165981273 19:39726459-39726481 GGCTGTGGCTCTTTACCAAGTGG - Intergenic
929077804 2:38092843-38092865 GGGTGTGGCTGGTAACCTGGGGG - Intronic
929390946 2:41467654-41467676 AGATGTAGCTGTTCCCCTGGTGG - Intergenic
931570393 2:63663019-63663041 GGCTAGGGCTGTTCACCTTGAGG - Intronic
934052724 2:88223850-88223872 GGATGCTGCTGTGCACCTGGAGG - Intergenic
937324928 2:120984840-120984862 GGATATCGCTGTGCCCCTAGAGG - Intronic
941491925 2:166153286-166153308 GGAAGTGGCTGCCCAGCTAGGGG - Intergenic
946193517 2:218020232-218020254 TGCTGTGGCTGTTCACCCACTGG - Intergenic
947920392 2:233866360-233866382 GGAGGTGGCTGGTCACCTGGTGG + Intergenic
948592558 2:239060670-239060692 GGATGTGTTTGTTCACCTTTAGG - Intronic
1173799050 20:45883363-45883385 GGATGTGGGTGGTGACCTCGAGG - Exonic
1176004092 20:62850411-62850433 GGATGGGGCTGTTTACTGAGAGG - Intronic
1176257699 20:64160724-64160746 GGAGGTGGCTGTTTCCCCAGGGG - Intronic
1178811824 21:35890862-35890884 TGATGTGACTATTCACCTTGAGG - Intronic
1179096092 21:38315590-38315612 GTATGTGGATGTTCACTTAGAGG - Intergenic
1180624606 22:17185895-17185917 GGAGGAGGCTGTTCACATGGAGG - Intronic
1182625086 22:31639823-31639845 GGCTTTGGCTGTTGACATAGAGG - Intronic
1182640895 22:31766584-31766606 GGATGTGACCCTTGACCTAGTGG + Exonic
1183412253 22:37661756-37661778 GGATGGAGCTGTTCACCTTTGGG - Intronic
949360248 3:3224085-3224107 GGATGAGGCTGCCCACATAGGGG - Intergenic
952145419 3:30526686-30526708 GGAGGAGGCTGTTGACCTGGGGG + Intergenic
953957777 3:47244891-47244913 GGATGTTGATGGCCACCTAGTGG - Exonic
955398948 3:58577530-58577552 GGAAGTGGCCGTGCACCAAGTGG - Intronic
961602101 3:128070286-128070308 GGATTTGTCTGTGCACCTATTGG + Exonic
962741865 3:138367745-138367767 GGATGTGGCTCTTGTCCTCGTGG + Intronic
965635423 3:170775665-170775687 GGATGTGACTGCTCCCATAGTGG + Intronic
968673779 4:1866071-1866093 GCCTGTGGCTGATCACCGAGGGG + Intergenic
974688732 4:65267522-65267544 GGTTGTGGTTCTTCACCTGGTGG - Intergenic
980817597 4:137968214-137968236 GGATGAGTCTGTGCACCCAGTGG - Intergenic
981154267 4:141415289-141415311 GTCTGTGGCTGTTCACATGGTGG + Intergenic
984754392 4:183312462-183312484 GGATGGGGCTATTCACCTGAAGG - Exonic
986577133 5:9223991-9224013 GGATGTGGCTCTTCTTCGAGTGG + Intronic
988233166 5:28506112-28506134 ACATCTGGCTGATCACCTAGAGG + Intergenic
988430885 5:31117286-31117308 GGATGTGGGTGCTCATCAAGGGG + Intergenic
998405809 5:141874190-141874212 GGCTGCTGCTGTTCACCCAGGGG + Intronic
1000908673 5:166994817-166994839 AGATGAGGCTCTTCACCTCGAGG + Intergenic
1003859958 6:10313940-10313962 GGATGTAGCTGTTTACTTGGAGG - Intergenic
1006639203 6:35480359-35480381 GTATGTGGCTGGACACCTAGGGG + Exonic
1007435274 6:41806161-41806183 GGAGGTGGCTGAGCACCTGGAGG + Exonic
1009927109 6:70133350-70133372 GGATGTGGCTGCTAAACCAGGGG - Intronic
1013287346 6:108692797-108692819 GGAAACGGCTGCTCACCTAGGGG + Intergenic
1015878388 6:137846747-137846769 AGATGTGGCTGTGCTCCAAGGGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1025027365 7:55527618-55527640 GGATGAGGCTTTTTACCTACTGG - Intronic
1025631768 7:63279013-63279035 AGATGTGGCTCATCACGTAGAGG + Intergenic
1025650811 7:63467370-63467392 AGATGTGGCTCATCACGTAGAGG - Intergenic
1027412819 7:77940023-77940045 GTATATGGCTGTTCACCTTGAGG - Exonic
1027890953 7:83974178-83974200 GCCGGTGGCTGGTCACCTAGGGG - Intronic
1033002350 7:137520726-137520748 GGATATGGCTCCTCACCTCGTGG + Intronic
1033180450 7:139172742-139172764 GGAAGCGGCTGGTCACCTGGTGG + Intronic
1035276843 7:157753022-157753044 TGGTGTGGCTGTTCTCCAAGGGG + Intronic
1037886275 8:22598123-22598145 GGAAGTGGCTGTTTACCGGGAGG - Intronic
1038201717 8:25419055-25419077 GTATGTGGCTGTTCTGCTTGTGG + Intergenic
1038333467 8:26627937-26627959 GGAGGTGAATGTTCACCAAGCGG + Exonic
1039354038 8:36795430-36795452 GGAAGTGGCTGGTCAACGAGGGG + Intronic
1040861998 8:52008585-52008607 GGATGTGGCTGAGCCCCGAGCGG - Intergenic
1043756699 8:84012338-84012360 TGCTGTGGCTCCTCACCTAGGGG - Intergenic
1044253547 8:90032778-90032800 GGATGTGTCTGTGAAACTAGGGG + Intronic
1047229139 8:122981019-122981041 GGAAGTGGCTGTGCACCAGGTGG - Intergenic
1048900545 8:139033228-139033250 TGGAGTGGATGTTCACCTAGAGG - Intergenic
1051424816 9:16922336-16922358 CTATATGGCTGTTCCCCTAGAGG + Intergenic
1053594081 9:39542451-39542473 GGTTGTGACTGTTCAACTGGTGG - Intergenic
1060550285 9:124481726-124481748 GCATCCTGCTGTTCACCTAGTGG + Exonic
1061199866 9:129131578-129131600 TGAGGTGGCTGTTTACCTAAAGG + Exonic
1061224881 9:129275646-129275668 GGACGTGGCTGTTGACGTAGGGG - Intergenic
1186671564 X:11772189-11772211 GGAGGCGGCTGGTCACCTGGGGG - Exonic
1186868659 X:13747583-13747605 GCAGGTGGCTGCTAACCTAGGGG + Intronic
1187474841 X:19601747-19601769 AGGTGTGGCTGTTCCTCTAGGGG - Intronic
1189475537 X:41352149-41352171 GGATGTGGCTGTTCACCTAGAGG - Intronic
1193504280 X:82321387-82321409 AGATATTGCTGTTCACTTAGTGG - Intergenic
1193979140 X:88159328-88159350 GGTTGTGGTTTTTCACCTGGTGG - Intergenic
1194323456 X:92480876-92480898 GGCTGTGGCAGGGCACCTAGTGG + Intronic
1198701562 X:139402202-139402224 GGTTGTGGTTTTTCTCCTAGTGG - Intergenic
1200631556 Y:5594042-5594064 GGCTGTGGCAGGGCACCTAGTGG + Intronic
1201788922 Y:17816468-17816490 GCAGGTGGCTGGTAACCTAGGGG + Intergenic
1201812631 Y:18089519-18089541 GCAGGTGGCTGGTAACCTAGGGG - Intergenic
1201849530 Y:18462726-18462748 GCAAGTGGCTGGTAACCTAGGGG - Intergenic
1201883788 Y:18857649-18857671 GCAAGTGGCTGGTAACCTAGGGG + Intergenic