ID: 1189482191

View in Genome Browser
Species Human (GRCh38)
Location X:41400587-41400609
Sequence TATATCATGTGGAAGCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189482191_1189482195 16 Left 1189482191 X:41400587-41400609 CCCTCATGCTTCCACATGATATA No data
Right 1189482195 X:41400626-41400648 AGCATCATCTATAATGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189482191 Original CRISPR TATATCATGTGGAAGCATGA GGG (reversed) Intergenic
No off target data available for this crispr