ID: 1189490667

View in Genome Browser
Species Human (GRCh38)
Location X:41469313-41469335
Sequence GAATTCCTAGCAAATACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189490667_1189490670 -7 Left 1189490667 X:41469313-41469335 CCAGGGGTATTTGCTAGGAATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1189490670 X:41469329-41469351 GGAATTCGGGAGTACTGATGAGG 0: 1
1: 0
2: 0
3: 4
4: 79
1189490667_1189490672 -3 Left 1189490667 X:41469313-41469335 CCAGGGGTATTTGCTAGGAATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1189490672 X:41469333-41469355 TTCGGGAGTACTGATGAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1189490667_1189490673 -2 Left 1189490667 X:41469313-41469335 CCAGGGGTATTTGCTAGGAATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1189490673 X:41469334-41469356 TCGGGAGTACTGATGAGGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 98
1189490667_1189490676 19 Left 1189490667 X:41469313-41469335 CCAGGGGTATTTGCTAGGAATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1189490676 X:41469355-41469377 GGTAGAAATTATGAATCGGTGGG 0: 1
1: 0
2: 1
3: 2
4: 80
1189490667_1189490675 18 Left 1189490667 X:41469313-41469335 CCAGGGGTATTTGCTAGGAATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1189490675 X:41469354-41469376 GGGTAGAAATTATGAATCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 78
1189490667_1189490674 15 Left 1189490667 X:41469313-41469335 CCAGGGGTATTTGCTAGGAATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1189490674 X:41469351-41469373 GAGGGGTAGAAATTATGAATCGG 0: 1
1: 0
2: 1
3: 22
4: 204
1189490667_1189490671 -4 Left 1189490667 X:41469313-41469335 CCAGGGGTATTTGCTAGGAATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1189490671 X:41469332-41469354 ATTCGGGAGTACTGATGAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189490667 Original CRISPR GAATTCCTAGCAAATACCCC TGG (reversed) Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
904823103 1:33257713-33257735 GGATTTCCAGCAAAGACCCCTGG + Intronic
905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG + Exonic
907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG + Intronic
913842761 1:123454184-123454206 GAATTCCTAGTAACTTCCCTTGG + Intergenic
916691056 1:167190467-167190489 GAACTCCCAGAAAATCCCCCTGG + Intergenic
918741430 1:188135974-188135996 CAATTTCTAGCAAAAGCCCCAGG - Intergenic
921377204 1:214486706-214486728 CAATGCTTAGCAAATGCCCCTGG - Intronic
1064576269 10:16748979-16749001 TAATCCCTAGCAAATACCAGGGG + Intronic
1065444407 10:25782979-25783001 GAAATCCAAGAAAATACCACAGG + Intergenic
1068572161 10:58642164-58642186 GAATACCTGGAAAATAGCCCAGG + Intronic
1071731808 10:88255766-88255788 GAATTCCTAGCCAATCATCCAGG + Intergenic
1080454865 11:32408948-32408970 GAATTCCTAGGGAATACTCCTGG - Intronic
1082755865 11:57075743-57075765 AAACTCCTACCAAACACCCCAGG - Intergenic
1085946310 11:81277529-81277551 CTCTTCCTAGCAAATACCCAGGG - Intergenic
1090729351 11:129556320-129556342 GAGTTTCTAGAAAATACCTCAGG + Intergenic
1093232269 12:16560818-16560840 GAATTCATAGCAAAAATCTCTGG + Intronic
1097272601 12:57786431-57786453 GAATTCGTAACTAATACCCAGGG - Intronic
1107730087 13:43339855-43339877 ATATTCCTGGCAAATACCACAGG - Intronic
1108204140 13:48071375-48071397 CTCTTCCTAGCAAATACCCGGGG - Intronic
1109074874 13:57821927-57821949 GCATTAATAACAAATACCCCAGG + Intergenic
1109825890 13:67721756-67721778 GAATTGTAAGCAAATACCCAAGG + Intergenic
1112602453 13:100869775-100869797 GAATTTTTAGCAAATACTCCAGG + Intergenic
1116103058 14:40465917-40465939 CTCTTCCTAGCAAATACCCAGGG - Intergenic
1127078640 15:55352953-55352975 GAGATCCTAGCAAAAACCACAGG + Intronic
1136564321 16:31061088-31061110 GCATTCCTAGCAAAGCCACCAGG + Exonic
1137228832 16:46541923-46541945 GAAGTCCTAGCCAGTACCACAGG - Intergenic
1140037747 16:71383927-71383949 AAATTCACAGCAAATAACCCAGG + Intronic
1140601843 16:76485662-76485684 GCATTACTAACAAGTACCCCAGG + Intronic
1141215674 16:82021054-82021076 GCATTCCTAGCAGCCACCCCGGG + Intergenic
1141619719 16:85230657-85230679 AGATTCTTAGCAAATACCCAAGG + Intergenic
1149373142 17:56016410-56016432 GAAATCATAGCACATATCCCTGG + Intergenic
1150170827 17:62992216-62992238 GAATCCCCAGCAGATACCCAAGG + Intergenic
1153063771 18:1021803-1021825 GAAGTCCAAGAAAATATCCCAGG + Intergenic
1153660784 18:7324343-7324365 GATTTCCTTTCAAATACTCCAGG - Intergenic
1156098187 18:33561744-33561766 CTCTTCCTAGCAAATACCCAGGG + Intergenic
1156772498 18:40746500-40746522 GAATTCCTAGTATATACTACTGG + Intergenic
1156788185 18:40940315-40940337 GAAATCCTAGCTAAAACCCGTGG - Intergenic
1159418196 18:68181215-68181237 GAATTCCTAGCACAAGCCTCCGG + Intergenic
927488588 2:23505642-23505664 GAAGTCCTCCCAAGTACCCCTGG + Intronic
928676424 2:33655700-33655722 CTCTTCCTAGCAAATACCCAGGG - Intergenic
930847292 2:55919411-55919433 AAATTCTTAGCAAGTATCCCAGG + Intronic
932181851 2:69653569-69653591 GATAGCCTAGCAATTACCCCTGG + Intronic
933710449 2:85321625-85321647 GAATTTTTATCAAATACCCTTGG + Intronic
940153863 2:150632307-150632329 GAACTTCTAGCAACTAACCCTGG + Intergenic
941085402 2:161111714-161111736 GACTTCTTAGCATATACCCAGGG - Intergenic
946042686 2:216795981-216796003 GAATCCCTACCCAAAACCCCAGG - Intergenic
947158267 2:227185779-227185801 GATTTCCTGGCAAAATCCCCAGG + Intronic
947979788 2:234399043-234399065 GAATCCCTTGCCAATACCCTCGG - Intergenic
1170683030 20:18543797-18543819 GAATTTCTAGTAAGTTCCCCTGG - Intronic
1171016314 20:21545034-21545056 GTATTCCTAGCATCCACCCCAGG - Intergenic
1171425125 20:25044134-25044156 GAATTCCTGGCCCAGACCCCAGG + Intronic
1172135784 20:32685802-32685824 AATTTCCTAGAAAATACCCCTGG - Intergenic
1173657100 20:44706879-44706901 GAAGGCCCAGCAAATAGCCCTGG - Intergenic
1181988351 22:26817630-26817652 GATTTCCTAGCATATGCCCATGG - Intergenic
1182833786 22:33325084-33325106 GAATTCAGAGGAAATACACCTGG - Intronic
950959145 3:17086475-17086497 GAATTCCTAGAAGATAACACAGG + Intronic
953843813 3:46410892-46410914 GCATTTCTAACAAATTCCCCAGG + Intronic
956039609 3:65132204-65132226 GAATTCCTAGAAAAGTACCCAGG + Intergenic
956039831 3:65134076-65134098 GAATTCCTAGAAAAGTACCCAGG + Intergenic
956991610 3:74772834-74772856 GTATTCCTAGCAATCACCACAGG + Intergenic
959800857 3:110494374-110494396 GAACTCTGAGCAAATATCCCAGG + Intergenic
963434073 3:145245309-145245331 CTCTTCCTAGCAAATACCCAGGG + Intergenic
964879473 3:161407627-161407649 AGATTCCTAGCAAATCCCCGGGG - Intergenic
966295847 3:178421950-178421972 CAATTCCTCTCAAATACCCACGG - Intronic
967780294 3:193431324-193431346 TAATTCCTATTAAATACCCATGG + Intronic
969046217 4:4338734-4338756 GCATTCCCTGCCAATACCCCAGG + Intergenic
971598236 4:28559441-28559463 GAAAGCCCAGCAAATATCCCAGG - Intergenic
973169005 4:47115229-47115251 GAATTCCTAGGAAAAAGCCTGGG - Intronic
975756584 4:77577776-77577798 CTCTTCCTAGCAAATACCCGAGG - Intronic
976321625 4:83723561-83723583 GTATTCCTAGCATATAGCACAGG + Intergenic
978202140 4:106034766-106034788 GGATACCTGGCAAATAACCCTGG + Intergenic
979104587 4:116667806-116667828 CACTTCCTAACAAATACCCAGGG - Intergenic
989247225 5:39267830-39267852 GAATTCCTAGCAAAGTAGCCAGG - Intronic
989715218 5:44454767-44454789 CTCTTCCTAGCAAATACCCAAGG + Intergenic
990479605 5:56196835-56196857 GCATTCTTACCAAATACCCTAGG + Intronic
992769389 5:80033308-80033330 AGATTCCTAGCAAATACTCTAGG + Intronic
993234534 5:85286668-85286690 GAATTTATAGCAAATAACCATGG + Intergenic
993330121 5:86589244-86589266 GAATTACTAGCAAACACCAGAGG + Intergenic
994025907 5:95083221-95083243 GAATTTCCAGCAAATACACTGGG + Intronic
999671776 5:153964876-153964898 GAATTGCTAGCACCTAACCCAGG + Intergenic
1000372895 5:160554236-160554258 GAAATCCCAGCAAAGTCCCCTGG - Intergenic
1005720787 6:28600028-28600050 GAATTTCTAGCAAATAACATAGG + Intronic
1010541646 6:77099263-77099285 CTTTTCCTAGCAAATACCCGGGG - Intergenic
1011591109 6:88971709-88971731 CTCTTCCTAGCAGATACCCCAGG - Intergenic
1012804665 6:103878935-103878957 CTCTTCCTAGCAAATACCCAGGG - Intergenic
1016978220 6:149829866-149829888 GGTTTCCTAGCGAATACCACTGG + Intronic
1020272905 7:6607573-6607595 GAATTCCAAGCAGAAGCCCCAGG - Intronic
1023811679 7:43916842-43916864 CTCTTCCTAGCAAATACCCGAGG - Intronic
1028778028 7:94702653-94702675 ACATTCATAGCAAAGACCCCAGG + Intergenic
1031384485 7:121131235-121131257 GAATTCTTAGGACATATCCCAGG + Intronic
1034450210 7:151133229-151133251 CAATTCCTAGCCAATGCCCTTGG - Intronic
1035662555 8:1359072-1359094 GCATTTCTAGCAAATTCCCAGGG + Intergenic
1036055439 8:5247596-5247618 AAATTCCTTGCAGAGACCCCAGG - Intergenic
1036222678 8:6933971-6933993 GAAGTTCTAGCAGAGACCCCAGG + Intergenic
1036508223 8:9375953-9375975 GAAATCCTAACAAATCACCCTGG + Intergenic
1039969647 8:42310405-42310427 GAACACGTAGCAAACACCCCTGG - Intronic
1042817407 8:72892485-72892507 GGATGCCTAGCAAATTACCCTGG - Intronic
1044599208 8:93986913-93986935 GGAATGCTAGCAAATACTCCTGG + Intergenic
1045438724 8:102189445-102189467 GATTTGAAAGCAAATACCCCTGG + Intergenic
1045816062 8:106277839-106277861 GAAATTCCAGCAAATATCCCTGG + Intronic
1050131428 9:2416846-2416868 GAATTGCTTGCAAATATCCGTGG + Intergenic
1052059375 9:23942043-23942065 CTCTTCCTAGCAAATACCCAAGG + Intergenic
1052836673 9:33255303-33255325 GAATGCCTAGAAAATACACACGG + Exonic
1053265467 9:36709982-36710004 GTATTCCTAGAAATTTCCCCAGG + Intergenic
1054781404 9:69169240-69169262 GAATGCCTACCATATACCCTGGG - Intronic
1061771783 9:132930121-132930143 GCATTTCTAGCAAGTATCCCAGG - Intronic
1062115575 9:134806386-134806408 CAATCCCAAGGAAATACCCCTGG - Intronic
1187679556 X:21753309-21753331 GAAATCCTAGCACACACCGCTGG - Intronic
1189490667 X:41469313-41469335 GAATTCCTAGCAAATACCCCTGG - Intronic
1191900576 X:66035941-66035963 GAATTTCCAGCAAATTCCCAGGG - Intronic
1193468164 X:81871535-81871557 CTCTTCCTAGCAAATACCCATGG + Intergenic
1194955272 X:100171931-100171953 GAATTCCCAGCAAAGACTCAGGG + Intergenic
1199448385 X:147953119-147953141 CAATTCCTACCAAAGGCCCCTGG - Intergenic
1200898560 Y:8403503-8403525 CTCTTCCTAGCAAATACCCAGGG - Intergenic