ID: 1189491391

View in Genome Browser
Species Human (GRCh38)
Location X:41473933-41473955
Sequence CGAAGGCGGCGAGTTCGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189491391_1189491399 14 Left 1189491391 X:41473933-41473955 CCTGCGCGAACTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1189491399 X:41473970-41473992 CGCGTGCCGGGCGCGCTGCGCGG 0: 1
1: 0
2: 0
3: 21
4: 212
1189491391_1189491395 2 Left 1189491391 X:41473933-41473955 CCTGCGCGAACTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1189491395 X:41473958-41473980 AACCTGTTCCGCCGCGTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 30
1189491391_1189491400 19 Left 1189491391 X:41473933-41473955 CCTGCGCGAACTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1189491400 X:41473975-41473997 GCCGGGCGCGCTGCGCGGCCTGG 0: 1
1: 0
2: 5
3: 53
4: 384
1189491391_1189491394 1 Left 1189491391 X:41473933-41473955 CCTGCGCGAACTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1189491394 X:41473957-41473979 CAACCTGTTCCGCCGCGTGCCGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189491391 Original CRISPR CGAAGGCGGCGAGTTCGCGC AGG (reversed) Exonic