ID: 1189497130

View in Genome Browser
Species Human (GRCh38)
Location X:41518953-41518975
Sequence CAAGGGATACAGCAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189497130 Original CRISPR CAAGGGATACAGCAAGAGGA AGG Intronic
900197508 1:1384227-1384249 CAAGGGAGTGAGCAAGAGGCAGG - Intergenic
902802589 1:18839604-18839626 CCAGGGCTACACCATGAGGAGGG - Exonic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
904895218 1:33812212-33812234 GAAGGGCCACAGCAAGTGGAGGG + Intronic
905871101 1:41405070-41405092 CAAGGGTTCCAGCAAGAACAAGG - Intergenic
906156592 1:43617591-43617613 CAAGGGGGAGAGCAAGGGGATGG - Intronic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
910300542 1:85702182-85702204 CAATGGATTCACCAAGAGGAAGG - Exonic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
913317252 1:117563632-117563654 CAAGAGCTGCAGCAAGAGGTTGG + Intergenic
915212672 1:154322214-154322236 GGAGAGATACAGAAAGAGGAGGG - Intronic
915748943 1:158186665-158186687 GGAGGGACACAGCAGGAGGAAGG + Intergenic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
917183396 1:172323658-172323680 GAAGGGGTACAGCAATAGGATGG + Intronic
918631113 1:186719524-186719546 CAAGAGAGAGAGCAAGAGGTGGG - Intergenic
919254721 1:195106097-195106119 AAAAGGATACAGGAAGATGAGGG - Intergenic
919381394 1:196866063-196866085 CAAGGGATACTGGAATAGTAAGG - Intronic
920306730 1:205023180-205023202 CAAGCGGTGCAGAAAGAGGAGGG - Intergenic
920772900 1:208906508-208906530 GAAGGGAGACAGTAAGAGGGAGG + Intergenic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921184145 1:212655787-212655809 GAAGGGATACAGGATGAGGAAGG - Intergenic
922229270 1:223671639-223671661 CAAGGGGAACAGCAAGAAAATGG + Intergenic
922552339 1:226505027-226505049 AGAGGGATACTGGAAGAGGATGG + Intergenic
923745989 1:236700720-236700742 CCCGGAATACAGCCAGAGGAAGG + Intronic
1063088741 10:2842669-2842691 CAAGGAATACAGGAAGAGAAGGG - Intergenic
1064596479 10:16950587-16950609 GAAGGGATAAAGCAAGGGAAGGG + Intronic
1064913858 10:20434792-20434814 CAAGAGAGGCAGCAAGAGGCAGG - Intergenic
1065692299 10:28347056-28347078 AAAGGGAGAAAGAAAGAGGAAGG + Intergenic
1066435423 10:35393006-35393028 CACAGGAGACAGCAAGGGGAGGG - Intronic
1067539951 10:47144030-47144052 CAATGGATGGAGCAAGAGGTGGG - Intergenic
1068917739 10:62451100-62451122 CAATGGCTACAGAATGAGGAAGG + Intronic
1070551960 10:77496941-77496963 CAAAGGATTCAGGAAGAGCAAGG - Intronic
1071012783 10:80957265-80957287 CAAGGGAGAGACCAAGTGGAGGG + Intergenic
1071737818 10:88321283-88321305 CCTGGGATACAGCAAAAGCAGGG + Intronic
1072737963 10:97891844-97891866 CCAGGGACACAGCGAGAGGCGGG - Intronic
1073374656 10:103022866-103022888 CAAGAGAGAGAGCAAGAGAAAGG + Intronic
1074856770 10:117479741-117479763 CCAGGTATAGAGCAAAAGGAAGG + Intergenic
1075333092 10:121588595-121588617 TATGGGATACAGCAAAAAGATGG + Intronic
1075417488 10:122275704-122275726 CAAGGAAAAAAGCACGAGGAGGG - Intronic
1076136176 10:128046823-128046845 CAAAGGACACAGTAAGAGGCCGG + Intronic
1076624939 10:131815996-131816018 CAGAGGATACACCAACAGGAAGG + Intergenic
1077606123 11:3613929-3613951 GGAGGGAGACAGCAAGAGCATGG + Intergenic
1078496089 11:11818661-11818683 CCAGAGATAGAGCAAGGGGAGGG - Intergenic
1078970237 11:16401747-16401769 TAAAGGATACAGCAATAGGGTGG + Intronic
1079224940 11:18596769-18596791 CAGAGGATACTACAAGAGGAAGG + Intergenic
1079502214 11:21114206-21114228 TAAGGGATATAGAAAGAGGTGGG - Intronic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1083313189 11:61796441-61796463 CAAGGGATCCACTAAGAAGAAGG + Exonic
1083997435 11:66279176-66279198 GAAGGGGGACAGGAAGAGGAGGG - Intronic
1084972693 11:72780476-72780498 GAAGGGAAAGAGCAAGAGCAGGG + Intronic
1085687465 11:78636967-78636989 TATGGGATACAGCAAAAGCAGGG + Intergenic
1086255003 11:84865186-84865208 CCACGGATACAGCAAGAGTCAGG - Intronic
1086457102 11:86969774-86969796 AAATGGAGACAGCAAGAGAAAGG + Intergenic
1090442103 11:126732852-126732874 CAAAGGAGATAGCAAGAGGCTGG + Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1091951095 12:4593673-4593695 CAAGGGCTACAGTCAGAAGAGGG - Intronic
1094086679 12:26600877-26600899 CAAGGTAAATAGCAAAAGGAAGG - Intronic
1095354771 12:41258813-41258835 CAAAGGATAAAGCAAGATAAGGG + Intronic
1096633518 12:52944690-52944712 CCAAGGATAAAGGAAGAGGAAGG - Intronic
1099758623 12:86890228-86890250 CTAGGGATATACCAAGAAGAAGG - Intergenic
1100217754 12:92470056-92470078 CAAGGGAGTCCGGAAGAGGAGGG - Intergenic
1102928859 12:116847462-116847484 CAAGTTATACAGCCAGAGAACGG + Intronic
1103038738 12:117677408-117677430 GTAAGGACACAGCAAGAGGACGG + Intronic
1104070719 12:125343058-125343080 AAAGGGATACAGCTGGAGGTAGG + Intronic
1104074988 12:125381023-125381045 CAAGAGATACAGAGAGAGAAAGG + Intronic
1104494649 12:129225754-129225776 CAAGAGAGAGAGGAAGAGGAGGG + Intronic
1104894214 12:132153899-132153921 CCTGGGACACAGCAAGAGGACGG - Intergenic
1106216577 13:27707215-27707237 AAAGAGAGAGAGCAAGAGGAGGG + Intergenic
1107445914 13:40470400-40470422 AAAGGGAGAGAGAAAGAGGAAGG - Intergenic
1110651105 13:77942121-77942143 CAAGGGAGACAGCAGAGGGAAGG - Intergenic
1113090906 13:106616950-106616972 CAAGTGAGACAGCATGTGGAGGG - Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1115665591 14:35541721-35541743 CAAGGTAAACAGCAATGGGAGGG - Intronic
1116658972 14:47683309-47683331 TAAGGGAGACAGGAAGAAGAGGG - Intergenic
1117676054 14:58155940-58155962 GAAGAGAGACAGCAAGAGGAAGG + Intronic
1118720177 14:68588382-68588404 AAAGTGAAATAGCAAGAGGACGG - Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1120964997 14:90159094-90159116 CAAGGGATAATGCAACAAGAAGG - Intronic
1121698966 14:95937304-95937326 AAAGGGATACCTCAAGAGGAAGG + Intergenic
1122053578 14:99076969-99076991 CAAGGCATAAAGCCACAGGAAGG + Intergenic
1122118750 14:99540773-99540795 CAAGGGATCCATGAAGAGGGCGG - Intronic
1122196539 14:100091574-100091596 CAAAGGATGCAGGAAGAGGATGG - Intronic
1123978706 15:25578665-25578687 CATGGGAGACAGCAAGAAAATGG - Intergenic
1124210881 15:27764140-27764162 AGAGGGATACAGAAAGAGGGAGG + Intronic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1125375186 15:39021184-39021206 TAAGGGATACAGATAGAAGAAGG - Intergenic
1126729869 15:51671744-51671766 GGAGGTATACGGCAAGAGGAAGG + Intergenic
1127875041 15:63104736-63104758 CAAAGGATACAGCAAGGTGGTGG + Intergenic
1128028254 15:64457873-64457895 CAAGGCATCCAGCATGTGGAGGG + Intergenic
1128551965 15:68603693-68603715 CAGAGGACACAGCAAGAAGACGG + Intronic
1128670321 15:69569932-69569954 CAAGGGATTGAGAAACAGGAAGG - Intergenic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1131307398 15:91257733-91257755 GAAGGGGTGCAGCCAGAGGAAGG - Intronic
1131407219 15:92175343-92175365 CATGGGATGCAGGAAGTGGAGGG - Intergenic
1131441642 15:92464141-92464163 CAGGGTATACATCAAGAGGCCGG - Exonic
1133886004 16:9828191-9828213 ACAGGGATGGAGCAAGAGGAAGG + Intronic
1134692071 16:16197631-16197653 GAAGGGGTGCAGGAAGAGGAGGG + Intronic
1136027315 16:27477202-27477224 GAAGGGACAGAGGAAGAGGAGGG - Intronic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1138807424 16:60107322-60107344 AAAGGGAGACAACAACAGGAAGG + Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1141328534 16:83085670-83085692 CAAGCTCTACAGCAAGAAGAAGG + Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1143272543 17:5686461-5686483 GGGGGGATACAACAAGAGGACGG + Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143865594 17:9920734-9920756 ACAGGGCTCCAGCAAGAGGAAGG + Intronic
1145213835 17:21037091-21037113 CAGTGGATACAGCCAGATGATGG + Intronic
1145970534 17:28953897-28953919 CAAGAGTGACAGCAAGAGGCAGG - Intronic
1146487509 17:33255564-33255586 CACTGGTTACATCAAGAGGAGGG + Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1148075532 17:44933372-44933394 CAAGGGAGACGGCAGGAGGGTGG - Intronic
1148713130 17:49696467-49696489 CAAGGCATTCACCAAGGGGAGGG - Intergenic
1149493580 17:57102450-57102472 CAAGGCATACAGCCAAGGGATGG - Intronic
1149600308 17:57889145-57889167 TAAGGGATACATCCAGATGAGGG - Intronic
1149881006 17:60290441-60290463 CATGGGATACAGAAAGAATATGG - Intronic
1150722958 17:67628904-67628926 AAAGGGCCACTGCAAGAGGAAGG - Intronic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1151830194 17:76544938-76544960 CCAGGGATCCATCCAGAGGAAGG + Intronic
1153419404 18:4886957-4886979 CAAGAGATAGAGAAAGAGAATGG - Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1155012305 18:21792083-21792105 CAAGGGATACAGACAGGGAAAGG - Intronic
1156030503 18:32707286-32707308 CCATGGATACAGCTAGAGGAGGG - Intronic
1157187077 18:45549692-45549714 CAAGGGAGTCTGCAAGAGGAAGG + Intronic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1157330670 18:46701562-46701584 ATAGGGACACAGCAAGAAGAAGG + Intronic
1158707629 18:59807491-59807513 CAATGGAAGCAGCCAGAGGAAGG - Intergenic
1160606062 18:80050193-80050215 GAAGGGACAGAGCTAGAGGAAGG + Intronic
1160841261 19:1147912-1147934 CAAAGGACACAGCAAGGAGAAGG + Intronic
1161005667 19:1935053-1935075 CACGGGATCCAGTCAGAGGATGG - Intergenic
1162838145 19:13335222-13335244 GAAGGGAAACAGGAAGAGGTGGG - Intronic
1163495726 19:17645612-17645634 CCAGGGATCCAGCCAGAGCATGG - Intronic
1163682647 19:18692107-18692129 AGAGGGAGACAGCAAGAGCAGGG - Intronic
1166095103 19:40533468-40533490 CTAGGGGTTCAGCCAGAGGAGGG - Intronic
1166106538 19:40600656-40600678 TGAAGGCTACAGCAAGAGGAGGG - Intronic
1166690094 19:44817340-44817362 CAAGAAAAACAGCAAGAGAACGG + Intronic
1166792984 19:45408857-45408879 GAAGGGATGGAGCCAGAGGAGGG + Exonic
1167104710 19:47423553-47423575 GAAGGGACACAAAAAGAGGAGGG - Intergenic
1167402597 19:49282874-49282896 CAAGTGAGACAGCAAGGTGAGGG - Intergenic
1167619191 19:50551679-50551701 ACAGGGATAGAGCAAGAGGGAGG - Intronic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
928601653 2:32909410-32909432 CAAGGCAAACAGCAAGACCAAGG - Intergenic
929373388 2:41254238-41254260 CAAGGGAGACACAAAGAAGAAGG + Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
930162199 2:48169796-48169818 TATGGGACACAGCAAGAGGGTGG + Intergenic
930370078 2:50490764-50490786 CGAGGGAAAAACCAAGAGGATGG + Intronic
931522313 2:63112274-63112296 CAGGGGTTACAGGAAAAGGAGGG - Intergenic
932624529 2:73286778-73286800 GAAGGGAAACAGAAAGGGGAAGG - Intergenic
933826785 2:86168844-86168866 CAGGGGATACAACAAGAGAAAGG + Intronic
933968004 2:87445930-87445952 CCTGGGACACAGCAAGAAGAAGG - Intergenic
935451299 2:103212902-103212924 TAAGAGATAGATCAAGAGGAAGG - Intergenic
937235088 2:120426460-120426482 AAAGGGAGACAGCAAGATGGCGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937514531 2:122638388-122638410 TGAGAGATACAGTAAGAGGAGGG + Intergenic
937749724 2:125460808-125460830 CAAGGGAAAAAGAAAGAGAAGGG - Intergenic
938297168 2:130185570-130185592 CAAGGGTTACAGCAGGAGGGGGG + Intronic
938833367 2:135074606-135074628 GAAGGGAGACAGTAAGAGAAAGG + Intronic
939092485 2:137795479-137795501 GAGAGGATACAGCAAGAAGATGG - Intergenic
940477654 2:154185443-154185465 GAAGGGATAGAGAAAGAGAAAGG - Intronic
940890873 2:159034205-159034227 CAAGGGAGAAGGCAGGAGGAGGG - Intronic
941256187 2:163234252-163234274 CAAGAGAGACAGAAAGAGAAGGG + Intergenic
941361076 2:164552013-164552035 CAAGAGAGAAAGCAAGAGGGAGG + Intronic
941363943 2:164587280-164587302 CAAGTGATTAAGCAAGAGTAGGG + Intronic
942322772 2:174750422-174750444 CATGGGACACAGGAAGAAGATGG + Intronic
942864728 2:180659597-180659619 TAAGGGATACAGTGTGAGGAGGG + Intergenic
942895199 2:181045008-181045030 CAAGGTATACTACTAGAGGAAGG - Intronic
943919152 2:193679978-193680000 CAAGGGAAACAGAGAAAGGAAGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946336791 2:219042983-219043005 CAAGGGATTGAGCCTGAGGAGGG + Intergenic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
1168955229 20:1829865-1829887 GAGGGGCGACAGCAAGAGGAAGG + Intergenic
1172182646 20:33012956-33012978 CGAGGGATACAGTGAGGGGACGG + Intronic
1173064383 20:39696226-39696248 AAAGGGAGACAGTTAGAGGAAGG + Intergenic
1173265145 20:41472349-41472371 TAGGGGATACTGCAAGAGAAGGG - Intronic
1173410728 20:42807392-42807414 TAAGGGAAACTGCAAGAGGTTGG + Intronic
1173927378 20:46790956-46790978 CAAGAGAGAGAGCAAGAGGAGGG + Intergenic
1174087125 20:48017206-48017228 CAAGAGAGAGAGCAAGAGGGAGG - Intergenic
1174498250 20:50965032-50965054 CAAGGGGAACAGCAAGTGCAAGG + Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175515918 20:59569711-59569733 CAACTGATACAGCAAGATAAGGG - Intergenic
1175685834 20:61028145-61028167 CAAGGGATATAGAAAGAGCTGGG - Intergenic
1175925914 20:62471259-62471281 GAGTGGATACAGCCAGAGGAGGG + Intronic
1175929702 20:62487874-62487896 GAAGAGAAAGAGCAAGAGGAAGG - Intergenic
1176261374 20:64182642-64182664 CCAGGGATACAACAGGAGGATGG - Intronic
1176372275 21:6069218-6069240 CCACGCAGACAGCAAGAGGAGGG - Intergenic
1177703276 21:24666388-24666410 CAATGGACAAATCAAGAGGAAGG + Intergenic
1178240104 21:30889480-30889502 CAATGGATACAGAAAATGGAAGG - Intergenic
1178431572 21:32522520-32522542 AAAGGGAGAGAGAAAGAGGAGGG - Intergenic
1179751243 21:43469321-43469343 CCACGCAGACAGCAAGAGGAGGG + Intergenic
1181395485 22:22618387-22618409 CAAGGGACACAGAGAGGGGAGGG - Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181861191 22:25819381-25819403 CATGGAGTAGAGCAAGAGGAGGG + Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184379023 22:44133505-44133527 TAAGGGAAATAGCAAGAGAAAGG - Intronic
949586353 3:5442343-5442365 CAAGTGCTACAGAAAGAGCAAGG + Intergenic
949963787 3:9337606-9337628 CATGGGATAATGCAACAGGAAGG + Intronic
951780424 3:26356842-26356864 GAAGGGCTACAGGAAGAGCAAGG + Intergenic
952685194 3:36139543-36139565 TATGAGATTCAGCAAGAGGAAGG + Intergenic
953336415 3:42098118-42098140 GAAAGGAGACAGCAAGGGGAAGG - Intronic
953910316 3:46889515-46889537 CAAGAGTCACAGAAAGAGGAGGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
956646467 3:71462087-71462109 AAAGGAATTCACCAAGAGGAAGG + Intronic
957508064 3:81151463-81151485 CATGGGATGCAGAAATAGGATGG + Intergenic
958921507 3:100111195-100111217 CAATGGAGGCAGAAAGAGGATGG + Intronic
959459723 3:106610490-106610512 CAAGGGATATAGCTAAAGGATGG + Intergenic
961043936 3:123695999-123696021 CTAGGGGTACAGGAAGAGGAAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
962383477 3:134914838-134914860 CAAGGGCTGCAGCTATAGGAGGG + Intronic
962731823 3:138290426-138290448 CAAGGGGTACAGGAGGAGTAGGG + Intronic
963224030 3:142842796-142842818 TAAGGGATACAAGAAGAGGAAGG - Intronic
964058554 3:152491766-152491788 GTAAGGATACAGCAAGAAGATGG + Intergenic
964406271 3:156352243-156352265 AAAGGGAGGCAGCCAGAGGAAGG - Intronic
964903599 3:161691492-161691514 CTAGGGAAACAGCAAAAGCAAGG - Intergenic
966508680 3:180736157-180736179 CAGGTGGTACAGCAAGAGGTAGG - Intronic
967823795 3:193862544-193862566 CAAGAGATACAGCAAGATTGAGG - Intergenic
968877306 4:3279050-3279072 CAAGAGAGTCAGCAAGAGCAGGG - Intergenic
969235881 4:5864879-5864901 CAAGGAATGAAGCCAGAGGAGGG + Intronic
969444959 4:7239434-7239456 CAAGAGAGAGAGGAAGAGGAGGG - Intronic
970162341 4:13201579-13201601 GAAGGGTTAGAGTAAGAGGAAGG - Intergenic
972078528 4:35118026-35118048 AAAGGGATTTAGGAAGAGGATGG + Intergenic
972841214 4:42932228-42932250 TAATGCATACATCAAGAGGAGGG - Intronic
972938837 4:44172167-44172189 CAAGGGATGCAGCAAGAACAGGG - Intergenic
973601778 4:52549434-52549456 CCAGGGAACCAGGAAGAGGATGG + Intergenic
974267902 4:59609526-59609548 CAAGGGATGCAACAAGAGTGTGG + Intergenic
981215275 4:142158289-142158311 CATGGGATACAGCAAGAATGTGG - Intronic
981530473 4:145748537-145748559 TATGGGATACAGCAAAAGCAGGG - Intronic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
984614202 4:181877717-181877739 CCAGGCCTACAGCAAGAGGAAGG + Intergenic
984794977 4:183651659-183651681 CGTGGGATACAGAAAGAGAATGG + Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985958931 5:3284829-3284851 CATGGCATTCAGCAACAGGAAGG + Intergenic
985988915 5:3539068-3539090 CAAGGAAGACAGGAAGAAGATGG + Intergenic
987268729 5:16282665-16282687 CTAGAGATACAGGAAGAAGAAGG + Intergenic
988976771 5:36523858-36523880 CAAGGGAAACATGAAGATGAAGG - Intergenic
990104768 5:52245203-52245225 CAAGGGAGGGACCAAGAGGAAGG + Intergenic
991514312 5:67416803-67416825 CAAGGGATGGAGCAGGGGGAAGG + Intergenic
991913180 5:71581729-71581751 CAAGGGTTAGAGCTGGAGGAGGG - Intergenic
992222117 5:74583387-74583409 CATAGGATGCAGGAAGAGGAAGG - Intergenic
992457908 5:76933137-76933159 CAAAGGAGAGAGAAAGAGGAAGG + Intergenic
993430193 5:87823355-87823377 CAAGAGAGAGAGAAAGAGGAAGG + Intergenic
994839450 5:104904235-104904257 TAAGGCATAAAGCAAAAGGAGGG - Intergenic
995105999 5:108379468-108379490 TGAGTGATACAGCAAGAGGGTGG - Intronic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
997331614 5:133067175-133067197 CATGGGATATAGGAAGAGCAGGG + Intronic
997471624 5:134120487-134120509 TCAGGGAGACAGCAAGAGGCTGG - Intronic
997581281 5:135018965-135018987 CAAGGGTGACAGCATGAGAAAGG - Intergenic
998756625 5:145388077-145388099 CAAGAGATAAAGGATGAGGATGG + Intergenic
999699720 5:154217413-154217435 CAAGGGAGACAGTGAGAGGGTGG + Intronic
1000115471 5:158149517-158149539 CAAAGGTAAAAGCAAGAGGAAGG - Intergenic
1001200738 5:169714024-169714046 CCAGGGGGACAGCAAGAAGATGG + Exonic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003495263 6:6658038-6658060 CAAGGGGTAAAGGGAGAGGAAGG + Intergenic
1005913115 6:30327523-30327545 CAAGGAGTAGAGGAAGAGGAAGG + Intronic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009450314 6:63792182-63792204 CTGGGGATGCACCAAGAGGAGGG + Intronic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1011037760 6:82996562-82996584 CAAAGAATACAGCATGAGAAGGG + Intronic
1011388525 6:86823862-86823884 CCAGGGAGACTGTAAGAGGAAGG - Intergenic
1012272330 6:97229184-97229206 CTGGGCATACATCAAGAGGAAGG + Exonic
1012545555 6:100415069-100415091 CTAGGGAAAAGGCAAGAGGAGGG + Intronic
1015209341 6:130678967-130678989 GAAGGGATGTAGGAAGAGGAAGG + Intergenic
1015228163 6:130882603-130882625 AGAGGGATAGAGCCAGAGGAAGG + Intronic
1015474099 6:133639510-133639532 CAAGAGAGACAGCAAGCGAAGGG - Intergenic
1016696849 6:147006204-147006226 GAAGGTAGACAGTAAGAGGAGGG - Intergenic
1016826416 6:148392494-148392516 CAAGGGACTCAGCAAGTGGTTGG + Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017219617 6:151950628-151950650 GAAGAGACACAGGAAGAGGACGG + Intronic
1017343218 6:153350639-153350661 CAAAGGAAAATGCAAGAGGAAGG - Intergenic
1018954623 6:168400484-168400506 AAAGGCACACAGCAAGTGGAGGG - Intergenic
1021886485 7:25144685-25144707 AAAGGGCCACAGCCAGAGGAAGG + Intronic
1022476802 7:30716351-30716373 CAAGGGCTGCAGGAAGAAGAAGG - Intronic
1022712126 7:32861848-32861870 ATAGGGCTTCAGCAAGAGGATGG + Intergenic
1022911753 7:34905537-34905559 TTAGGGCTTCAGCAAGAGGATGG - Intergenic
1026277568 7:68893496-68893518 CAAGAGATAAAGCAAGAGTTTGG + Intergenic
1028357081 7:89923526-89923548 CATCAGGTACAGCAAGAGGATGG - Intergenic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1032370951 7:131351282-131351304 AAAAGAAAACAGCAAGAGGATGG - Intronic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032619116 7:133509522-133509544 CCAGGGAGAGAGGAAGAGGAAGG - Intronic
1033760381 7:144430802-144430824 CAAGGGATGCAGAAAGTAGAAGG - Intergenic
1034079339 7:148261899-148261921 GGAGGGACACTGCAAGAGGAAGG - Intronic
1034190085 7:149207285-149207307 CAACGCATCCAGCAAGGGGAAGG - Intronic
1034672099 7:152866714-152866736 GAAGGGAAACAGGAAGGGGAAGG - Intergenic
1036056419 8:5259908-5259930 TAAGGGAGATAGCAAGAGTAGGG - Intergenic
1036257088 8:7214425-7214447 CAAGGGACAAAGCCAGAGCAGGG + Intergenic
1036309138 8:7673024-7673046 CAAGGGACAAAGCCAGAGCAGGG + Intergenic
1036360397 8:8073095-8073117 CAAGGGACAAAGCCAGAGCAGGG - Intergenic
1036453069 8:8885623-8885645 GAAGGAAAACAGCAAAAGGAAGG + Intronic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1036927697 8:12923183-12923205 CAAGGGCAGCACCAAGAGGATGG + Intergenic
1039080018 8:33724839-33724861 CAAGGCATCCAGCAAGGGCAAGG - Intergenic
1039346502 8:36711099-36711121 CAAGGCATACAGCAGAAGGAGGG - Intergenic
1042144305 8:65712200-65712222 AAAAGGATACAGCTAGAGCATGG + Intronic
1042206768 8:66337460-66337482 GAAGAGATACAGGAAGAAGATGG - Intergenic
1042454842 8:68989200-68989222 CAAGGCGAACAGGAAGAGGAAGG + Intergenic
1046426061 8:114051162-114051184 CAAAGGATACAGCAAATGAAGGG - Intergenic
1047601083 8:126426528-126426550 CAGGGGGTACAGTAAGGGGAGGG + Intergenic
1047603150 8:126447564-126447586 CAAGAGAGAAAGCAAGAGAAAGG + Intergenic
1048216226 8:132498158-132498180 CAAGGGAAACTGGAAGAGGTGGG - Intergenic
1048384842 8:133902292-133902314 GAAGTCATCCAGCAAGAGGAAGG - Intergenic
1049433039 8:142574095-142574117 CATGGGAAACACCAAGAGCACGG - Intergenic
1049491724 8:142907458-142907480 TAAGGGAAAAAGGAAGAGGAGGG - Intronic
1050987188 9:12097900-12097922 AAAGGAATACAGAAAGTGGATGG - Intergenic
1051696540 9:19774020-19774042 CAAGGGAGACATCAAGAGAGAGG + Intronic
1052876939 9:33574557-33574579 CTAGGGATGCAGACAGAGGAGGG - Intergenic
1053269584 9:36740738-36740760 CAAGGGAGACGGAAAGAGGGAGG - Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1059723041 9:116980124-116980146 CTAGGGAGAGAACAAGAGGATGG - Intronic
1061505863 9:131031579-131031601 CCAGGGATACAGCTGGGGGACGG - Intronic
1186097422 X:6117146-6117168 CAAGGGAGAGAGAAAGAGTAGGG - Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187195988 X:17084078-17084100 CAAGGGATAGAGGAAGAAAAGGG - Intronic
1187677572 X:21732911-21732933 CAAAGGACACAGCAAGAATATGG + Intronic
1188209319 X:27401472-27401494 GAAGGGAAACTGCAAGAGAAAGG + Intergenic
1188246331 X:27840249-27840271 CAAGGGAGACAGTCAGAGGTAGG - Intergenic
1188403160 X:29772745-29772767 CAAAGGCTAAAGCAAGAGGAGGG - Intronic
1189426984 X:40910555-40910577 CAAGAGACAGAGCAAGAGAAAGG + Intergenic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1190320486 X:49176783-49176805 CCAGGGATACAGCAGGTGAAGGG + Intronic
1191842409 X:65522643-65522665 CAAGGGATGCAGGAAATGGAGGG + Intronic
1192168171 X:68838911-68838933 CCAGGGAGAGAGCCAGAGGATGG - Intronic
1193935079 X:87608698-87608720 AAAGGGATCAAGCGAGAGGAAGG + Intronic
1194372890 X:93096211-93096233 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1195100489 X:101550749-101550771 CAAGGGATACTGCAAGGGTTTGG - Intronic
1198562980 X:137871405-137871427 CCAGGGATACAGAGAGAGGATGG - Intergenic
1198854278 X:140999962-140999984 AAAGGAATAAAGAAAGAGGAAGG + Intergenic
1198877736 X:141245167-141245189 AAAGGAATAAAGAAAGAGGAAGG - Intergenic
1198908369 X:141587031-141587053 AAAGGAATAAAGAAAGAGGAAGG + Intronic
1199477669 X:148263385-148263407 GAAGGGACAGAGCAAGATGATGG - Intergenic
1199939796 X:152613790-152613812 CAAGGCAGAACGCAAGAGGAGGG - Intergenic
1200680928 Y:6210251-6210273 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1201334401 Y:12864642-12864664 AAAGGGAAAAAGCAAAAGGAGGG - Intergenic