ID: 1189498264

View in Genome Browser
Species Human (GRCh38)
Location X:41529334-41529356
Sequence CTGTGCAAGGGCAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189498258_1189498264 6 Left 1189498258 X:41529305-41529327 CCCACTCAGCAGTGCAGAGCAAT 0: 1
1: 0
2: 0
3: 7
4: 159
Right 1189498264 X:41529334-41529356 CTGTGCAAGGGCAAGGAGAAAGG 0: 1
1: 0
2: 3
3: 44
4: 531
1189498259_1189498264 5 Left 1189498259 X:41529306-41529328 CCACTCAGCAGTGCAGAGCAATG 0: 1
1: 0
2: 1
3: 12
4: 202
Right 1189498264 X:41529334-41529356 CTGTGCAAGGGCAAGGAGAAAGG 0: 1
1: 0
2: 3
3: 44
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189498264 Original CRISPR CTGTGCAAGGGCAAGGAGAA AGG Intronic
901135417 1:6989911-6989933 CTGGGTCAGAGCAAGGAGAATGG + Intronic
901945828 1:12702697-12702719 CTTTGGAAAGGCAAGGATAAAGG - Intergenic
902615442 1:17621064-17621086 TGGTGGAAGGGAAAGGAGAAGGG + Intronic
902735425 1:18397656-18397678 CTGTGCAAGACCATGGAGCAGGG + Intergenic
902884401 1:19394227-19394249 CTTTGAGAGGGCAAGGAGGACGG - Intronic
903632851 1:24789971-24789993 CTGTGGAGGGAAAAGGAGAAGGG + Intronic
903772639 1:25773611-25773633 CTCTGCAAGGGAAGGCAGAAAGG - Intronic
904660593 1:32081502-32081524 CTTTGGAAGGCCAAGGTGAATGG + Intronic
905270133 1:36782240-36782262 ATGGGCAAGGGCAAGGAGTGTGG - Intergenic
905570363 1:38999536-38999558 ATGTGCAAGAGCAATCAGAAAGG - Intronic
906506008 1:46380156-46380178 CTGTCCAAGGGAGAGAAGAAGGG - Intergenic
906530789 1:46522852-46522874 CTGTGCAGAGGCCAGGAGATGGG - Intergenic
906689223 1:47781683-47781705 CTCTGCCAGGGCAGGGAGAATGG + Intronic
906770071 1:48475745-48475767 CTGTGCAAGGGCAGTGAAGAAGG + Intergenic
906777775 1:48545197-48545219 CTCTGCAAGGGAAAGGAGATGGG + Intronic
907181480 1:52574052-52574074 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
907679027 1:56546266-56546288 CAGTGCAAGCTCAATGAGAATGG - Intronic
907917059 1:58881062-58881084 ATTAGCAAGGGCAAGGAGAAGGG + Intergenic
907940667 1:59084225-59084247 CTGAGCAAGGCCCAAGAGAAAGG + Intergenic
908378518 1:63572013-63572035 CTGGGCAAGTGAAGGGAGAAAGG + Intronic
908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG + Intronic
908772260 1:67607794-67607816 GTGGGCAAGGGCAAGGTGATGGG + Intergenic
908874088 1:68649717-68649739 CTGTGAAAGGGAAAGAAGGATGG - Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909377896 1:74961161-74961183 CTGTGCAGAAGCAGGGAGAAAGG - Intergenic
910715555 1:90225711-90225733 CCGTGCTAGGGCAATGCGAAAGG + Intergenic
911635572 1:100231870-100231892 CTGCGCTAGGGAAAGGAGGATGG - Intronic
912810897 1:112793677-112793699 TTGAGGAAGGGCAAGGGGAAAGG + Intergenic
913045802 1:115072677-115072699 CCGTGTGAGGGCAAGGGGAAGGG + Intronic
913089746 1:115468476-115468498 CTGTGCAGGGGCAAAGGGAAAGG + Intergenic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
913667547 1:121062425-121062447 CTCTGCAAGGTCAATGTGAAGGG - Intergenic
914900431 1:151708621-151708643 CTGTGCAGGGGCAGGGAAGAGGG + Intronic
915118747 1:153615724-153615746 CAGGGCAAGGCCAAGGTGAAGGG + Intronic
915250542 1:154585204-154585226 CTGTGGATGGGTAAGGAGACAGG - Exonic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
915874638 1:159599426-159599448 ATGTGAGAGGTCAAGGAGAATGG + Intergenic
915932102 1:160067242-160067264 CCTTGAAAGGGCAAAGAGAAAGG - Intronic
916188087 1:162152386-162152408 CTGTGCAGTGTCAAGGAGAGGGG + Intronic
917097884 1:171417796-171417818 CTGTGGGAGGACAAGGTGAAAGG - Intergenic
917504024 1:175612163-175612185 CTGTGGAAAGGCAAGGGCAAGGG - Intronic
918002676 1:180512470-180512492 TTGGGCAAGGGCAAGAAGAAGGG + Intergenic
918039968 1:180908028-180908050 CTGGGCAAAGGCAAGGAGACAGG + Intergenic
918861589 1:189833174-189833196 CTGAGCAAGGGCAAGTAAAGAGG - Intergenic
919922848 1:202176704-202176726 TTGTGCAGGGGCTGGGAGAAGGG + Intergenic
919990286 1:202704605-202704627 CCTTGCAAAGGCAGGGAGAATGG - Intronic
920908617 1:210193600-210193622 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
921094490 1:211874742-211874764 CAGTGCAACGGCAAGCTGAAGGG + Intergenic
921594328 1:217038209-217038231 CTCTGCTAGGGCAATGACAAAGG - Intronic
921807690 1:219474803-219474825 ATGTGCAAGGGTCTGGAGAAAGG - Intergenic
922346274 1:224699363-224699385 CTGCCGAAGGGCCAGGAGAAGGG - Intronic
922369060 1:224891538-224891560 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
922477947 1:225919770-225919792 CTGTCCAAGGGCTAGAAGTAGGG - Intronic
922844795 1:228676212-228676234 CTTTGGAAGGTCAAGGTGAAAGG - Intergenic
924728760 1:246693036-246693058 CTTTGGAAGGCCAAGGAGGAAGG - Intergenic
924931212 1:248733823-248733845 CTCTTCAAGGGCCAAGAGAATGG + Intronic
1062876931 10:950017-950039 CTGTGGAAGGCCAAGGAGGGTGG - Intergenic
1062941433 10:1424340-1424362 CTGTGTGAGAGCAAGAAGAAAGG + Intronic
1063139729 10:3245429-3245451 ATGATCAAGGCCAAGGAGAAGGG + Intergenic
1063626213 10:7692256-7692278 CTCTGCAAGGGCAATAAGACAGG - Intergenic
1064379605 10:14829365-14829387 CTTTGCAAGGCCAAGGCGAGAGG + Intronic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1065763907 10:29008860-29008882 CTGAGCAAGAACAATGAGAAGGG + Intergenic
1066361969 10:34740006-34740028 CCGTGCAAGTTCATGGAGAAGGG + Intronic
1066759492 10:38739006-38739028 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1066962126 10:42233755-42233777 CAGTGCCAGGGCAAGGACAAGGG + Intergenic
1067053086 10:43036489-43036511 CTGTGCAAGAGCGAGAAGAGAGG + Intergenic
1067124045 10:43500251-43500273 CTTTGGAAGGGCTAGGTGAAAGG - Intergenic
1067181085 10:43986485-43986507 GTGGGGAAGGGCAGGGAGAATGG - Intergenic
1067910176 10:50338650-50338672 TTGTGGAAGGGTAATGAGAAGGG - Intronic
1068501734 10:57847349-57847371 CTTTGCGAGGCCAAGGAGGAAGG + Intergenic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1071140671 10:82505958-82505980 CTGTGCAAGGGCCAGGCGCGTGG + Intronic
1073106948 10:101037536-101037558 CGGTGCAGGGGTCAGGAGAAGGG - Intronic
1073735496 10:106341230-106341252 ATGGGCAAGGGGAAGGAGAGAGG - Intergenic
1074931065 10:118126883-118126905 ATGTGCAGGGGCAAGGAGAATGG + Intergenic
1075582402 10:123631915-123631937 TTGTGCAGGGGCAAGGAAAAGGG + Intergenic
1075634550 10:124021532-124021554 ATCTGCAAGGGAAAGAAGAAGGG - Intronic
1075902245 10:126052248-126052270 CTGTGGAAGGGCTAAGAAAATGG + Intronic
1077718293 11:4602522-4602544 CTATGCAGGGGCAAAGATAAAGG + Intronic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1079194106 11:18309755-18309777 CTTTGCGAGGGCAAGGTGATTGG + Intronic
1079546844 11:21643288-21643310 CTGTGCTAGGGCAGTGAGGAAGG + Intergenic
1079750846 11:24194844-24194866 CTTTGGAAGGCCAAGGAGGATGG + Intergenic
1081130328 11:39371354-39371376 CTGTGGAAGGGCACCCAGAAGGG - Intergenic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1081660854 11:44887632-44887654 CTATGCAAGGGTCAGGAGAGGGG - Intronic
1081850677 11:46273174-46273196 CTGTGGAAGGCCCTGGAGAAAGG + Intergenic
1081968093 11:47181578-47181600 CTTTGGGAGGCCAAGGAGAAAGG + Intronic
1084384742 11:68836230-68836252 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
1084589782 11:70084032-70084054 GTCTGCAAAGGCAAGGAGGAGGG + Intronic
1085829107 11:79880786-79880808 CTGTTCAAGACCAAGCAGAATGG + Intergenic
1086832615 11:91584035-91584057 CTGTGGGAGGGCAAGGAACAAGG - Intergenic
1087221356 11:95549850-95549872 ATCTGCAAAGGCAAAGAGAAGGG - Intergenic
1088221152 11:107571134-107571156 ATGTGCAAGGACATGGAGCAAGG + Intergenic
1088230859 11:107672050-107672072 CTGTGCACGTGCAAAGAGAAAGG + Intergenic
1088246800 11:107826485-107826507 CTTTGGGAGGCCAAGGAGAATGG - Intronic
1089402663 11:118173289-118173311 ACGTGCAAAGGCATGGAGAAGGG - Intronic
1089492649 11:118893575-118893597 AACTGCAAGGGCAAGGAGACGGG - Exonic
1090820121 11:130334466-130334488 CTTTGGAAGGCCAAGGAGAGAGG - Intergenic
1091088320 11:132745492-132745514 CAGAGCAAGGGAGAGGAGAAAGG - Intronic
1091192464 11:133706963-133706985 AAGTGCAAGGGAAAGGAGAAGGG + Intergenic
1091326247 11:134690321-134690343 CTGTGTAAGGCCAAGAAGAGCGG + Intergenic
1091846237 12:3658214-3658236 CTGGGCCAGGGCATGGGGAATGG - Intronic
1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG + Intronic
1093147135 12:15580324-15580346 CAGTGAAAGGGAAAGTAGAAAGG + Intronic
1093378473 12:18460328-18460350 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1094186817 12:27652409-27652431 CTCTGAAAGGGAAAAGAGAAAGG + Intronic
1096236700 12:49933257-49933279 CTTGGCAAGGGCAAGGGCAAGGG + Intergenic
1098462007 12:70742385-70742407 ATTTTCAAGGGCAAGGAGTAGGG + Intronic
1098524033 12:71465951-71465973 TTGTGCAATGGAAAGGAGTATGG - Intronic
1098905250 12:76155190-76155212 CTGTTCACGGGTGAGGAGAAAGG - Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1100071382 12:90723811-90723833 CTGAGCAAGGGGCAGAAGAATGG - Intergenic
1101194628 12:102369804-102369826 CTCTGCTAGGGCAGGCAGAAGGG - Intergenic
1101421407 12:104554331-104554353 ATGTGCAAGGGCCAAGAGACAGG + Intronic
1101645428 12:106627018-106627040 CTGTGAAAGGGCAGAGGGAACGG - Intronic
1102081639 12:110103120-110103142 CTTTGGAAGGCCAAGGTGAAAGG - Intergenic
1102822245 12:115917646-115917668 CTGTGCAAAGGCCTGGAGATAGG + Intergenic
1106027227 13:25966890-25966912 CTGTGCAGGGGAAAGGGGATAGG + Intronic
1106056134 13:26239094-26239116 CTTTGGAAGGCCAAGGCGAATGG + Intergenic
1106251928 13:27988467-27988489 CTGTGCAAGGGCATCAATAAAGG + Exonic
1109836395 13:67863028-67863050 CTCTGAAAGGGTAAGGAGAGTGG + Intergenic
1110845116 13:80184513-80184535 CTGCTCAGGGTCAAGGAGAAGGG - Intergenic
1111416393 13:87950914-87950936 CTGTGGTTGGCCAAGGAGAAAGG - Intergenic
1111475052 13:88735136-88735158 CTTTGGGAGGGCAAGGTGAATGG + Intergenic
1111952860 13:94723851-94723873 CTGTGCACAGCCAAGGAGAAAGG + Intergenic
1111957293 13:94773626-94773648 CTTTTGAAGGGCAAGGAGAGTGG + Intergenic
1111960231 13:94802058-94802080 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
1111963180 13:94833825-94833847 CTATTCAAAGGGAAGGAGAAGGG + Intergenic
1113086745 13:106576695-106576717 CTATGCATGGCCAGGGAGAAGGG - Intergenic
1113612257 13:111655409-111655431 CTGTGCAATGGCAAGGCCAGTGG - Intronic
1113767959 13:112892741-112892763 CTGTGCAGGGGACAGGAGAGGGG - Intergenic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1115591862 14:34873698-34873720 CTGGGCAAGGGGAAGAGGAAGGG - Intronic
1117390789 14:55260489-55260511 CTTTGGAAGGTCTAGGAGAAAGG - Intergenic
1117426401 14:55602821-55602843 CTCTGGGAGGCCAAGGAGAAAGG - Intronic
1117602447 14:57390130-57390152 CTGACCAGGGGCAAGGAGGATGG - Intergenic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118201323 14:63676650-63676672 CTTTGGAAGGCCAAGGAGGATGG - Intergenic
1118457428 14:65957732-65957754 CTGTGCAAGGGCTAGGGGATGGG - Exonic
1118484204 14:66198480-66198502 TTCTGCAAGGGCAAGGAAGAAGG - Intergenic
1118657192 14:67965344-67965366 CAGGGCAATGGCTAGGAGAATGG - Intronic
1118779966 14:69001355-69001377 CTTTGGAAGGCCAAGGCGAAAGG - Intergenic
1119177587 14:72580553-72580575 ATGAGATAGGGCAAGGAGAAAGG + Intergenic
1120826744 14:88963052-88963074 CTATCCGAGGGGAAGGAGAAGGG - Intergenic
1121288464 14:92755162-92755184 CTGTGCAACTGGAAGGGGAAAGG - Intergenic
1121431428 14:93891062-93891084 CTCAGCAAGGGCATGCAGAATGG - Intergenic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122461942 14:101903320-101903342 ATGTGACAGGGCAAGGAGGAAGG + Intronic
1122820903 14:104344306-104344328 CTGTGCAGGGGAGAGGAAAAAGG - Intergenic
1202900613 14_GL000194v1_random:34452-34474 ATGTCCAAGGGCAGGAAGAAGGG - Intergenic
1123422152 15:20142907-20142929 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1123442921 15:20303710-20303732 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1123531380 15:21149447-21149469 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1125043519 15:35220583-35220605 CTGTGAAAGGGCAAAGAGGCAGG + Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1125130873 15:36282662-36282684 CTGAGCAAAGGCAAGAAGAGAGG - Intergenic
1125343986 15:38700467-38700489 ATGTGCAAGGCCTAGGGGAATGG + Intergenic
1125519048 15:40338195-40338217 GTGAGCAAGGGCAAGGACTAGGG + Intronic
1126320360 15:47415780-47415802 CTTTGCAAGGGCAAAGATTATGG - Intronic
1126514430 15:49519399-49519421 CTCTGCAAGGGCAGTGTGAAAGG - Intronic
1127284309 15:57519148-57519170 CTGTGCAAAGTCAATCAGAACGG - Intronic
1128354920 15:66919358-66919380 CTGAGCAGGGGCAAGGAGGCAGG + Intergenic
1128370535 15:67036016-67036038 CTGGGGGAGGGCGAGGAGAAGGG - Intergenic
1128557366 15:68641044-68641066 CTTTGAAAGGGCCAGGGGAAGGG - Intronic
1128642037 15:69346541-69346563 CTTTGCAAGGCCAAGGTGAGAGG - Intronic
1128778517 15:70342225-70342247 CTGAGCAAGGGCATGGAGACGGG + Intergenic
1129664517 15:77572079-77572101 GGGTCAAAGGGCAAGGAGAATGG + Intergenic
1131086371 15:89578926-89578948 CTGTCCAGGAGCAGGGAGAAGGG + Intronic
1131131701 15:89904569-89904591 CTCTGCCAGGGCCAGGAGAGAGG - Intronic
1131343750 15:91627245-91627267 GTGGGCAAGGGCAATGTGAAAGG - Intergenic
1131692045 15:94837694-94837716 CTTTGAAAGGCCAAGAAGAAAGG + Intergenic
1132933545 16:2470387-2470409 CTCTGCAGGGGCAGGGAGTAGGG - Intergenic
1133396373 16:5450628-5450650 CAGTGCCAAGGAAAGGAGAAAGG + Intergenic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1134397317 16:13877063-13877085 ATGTCCAAGGGCAAGAGGAACGG - Intergenic
1135891947 16:26365341-26365363 CTGGGCAGGGGCAGGGAGAGAGG + Intergenic
1136182654 16:28565053-28565075 ATGTCCAAGGGCAAGGGGAGAGG + Intronic
1136682359 16:31975783-31975805 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1136718322 16:32301972-32301994 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1136723291 16:32340157-32340179 CAGTGCCAGGGCAAGGACAAGGG + Intergenic
1136773638 16:32860174-32860196 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1136782617 16:32916951-32916973 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1136836696 16:33508242-33508264 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1136841634 16:33546235-33546257 CAGTGCCAGGGCAAAGACAAGGG + Intergenic
1136862684 16:33712768-33712790 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1136887177 16:33936899-33936921 CTATGCATGTGGAAGGAGAAAGG + Intergenic
1136896973 16:34001345-34001367 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1137249996 16:46734368-46734390 CTTTGGGAGGCCAAGGAGAATGG + Intronic
1137744852 16:50812989-50813011 CTGTGGCATGCCAAGGAGAAAGG - Intergenic
1139229722 16:65272149-65272171 CTCTTCAAAGGCATGGAGAAGGG + Intergenic
1139361121 16:66400902-66400924 GTGTGCAAGTGCAACGAGCAGGG + Exonic
1139572169 16:67820059-67820081 CTTTGCAAGGCCAAGGCGGATGG - Intronic
1139844376 16:69909223-69909245 CTGTCCAAGTTCAAGGAGAAGGG + Intronic
1140456046 16:75106177-75106199 CTGTGCAGAGCCCAGGAGAATGG - Intronic
1141286854 16:82680784-82680806 GCCTGAAAGGGCAAGGAGAAGGG + Intronic
1141511619 16:84515705-84515727 CTGTGCTGGGGCAGGGAGCAAGG + Intronic
1141714788 16:85720522-85720544 CTTTGGAAGGACAAGGACAAAGG + Intronic
1141753936 16:85978832-85978854 TTTTCCAAGGGCAAGGAGAAAGG - Intergenic
1203003141 16_KI270728v1_random:177608-177630 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1203008106 16_KI270728v1_random:215793-215815 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203076057 16_KI270728v1_random:1122285-1122307 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203085275 16_KI270728v1_random:1180939-1180961 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1203124160 16_KI270728v1_random:1560910-1560932 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203134746 16_KI270728v1_random:1714014-1714036 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1203146882 16_KI270728v1_random:1808543-1808565 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1203151799 16_KI270728v1_random:1846532-1846554 CAGTGCCAGGGCAAAGACAAGGG + Intergenic
1143517924 17:7429292-7429314 CTGGGCCAGGGATAGGAGAAAGG - Intergenic
1143666670 17:8366168-8366190 ATGGGCACGGGGAAGGAGAAAGG - Intergenic
1143737689 17:8924537-8924559 CTGTGCAAGGGAAAAGATAATGG - Intronic
1143781839 17:9233219-9233241 CCTTGCCAGGGAAAGGAGAAGGG + Intronic
1143934057 17:10463712-10463734 CTGTGCAGGGGCAATGGGGAAGG - Intronic
1144948133 17:18980263-18980285 CTGGCCATGGGGAAGGAGAAAGG - Intronic
1146258421 17:31405147-31405169 CAGTTCAGGGGCAAGGAGAGGGG + Intronic
1146497792 17:33338279-33338301 CTCTGGAAGGGCAAGGAGAATGG + Intronic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146711740 17:35047993-35048015 CTGTGGAAGGCCAAGGTGAATGG - Intronic
1146831940 17:36076963-36076985 CTGGTGAAGGGCGAGGAGAAAGG + Intergenic
1146984668 17:37203834-37203856 CTGGCCAAGGGCAAGAAGGAAGG + Intronic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147142879 17:38469121-38469143 CTATGCATGTGGAAGGAGAAAGG - Intronic
1147177296 17:38663885-38663907 CTTTGGGAGGGCAAGGAGTACGG - Intergenic
1147492093 17:40879169-40879191 CTTTCCAAGGGCAAGGCTAAAGG - Intronic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1149734024 17:58975391-58975413 CTGTGGAAGGCCAAGGAGGGAGG + Intronic
1150102057 17:62432423-62432445 CTTTGGAAGGCCAAGGAGATAGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1151898603 17:76996982-76997004 GTGTGTCAGGGCAAGGAGATGGG - Intergenic
1152083563 17:78203778-78203800 CTTTGGAAGGGCAAGGCGGACGG + Intronic
1152266118 17:79295878-79295900 CTGTGGCAGGGCATGGGGAAGGG + Intronic
1152279494 17:79376902-79376924 CTGAGCAAGGGAGAAGAGAATGG - Intronic
1152286981 17:79418499-79418521 CTGGCCAAGAGCAAGAAGAAAGG + Intronic
1152474389 17:80508642-80508664 CTGTGCAAGGCCTAGGATGATGG - Intergenic
1152743650 17:82029496-82029518 CTGGGCCAGGGACAGGAGAACGG + Intronic
1152750537 17:82060565-82060587 CTGCCCAAGGGAAAGGAGGAGGG - Intronic
1153813284 18:8770759-8770781 CTTAACAAGGCCAAGGAGAAAGG + Intronic
1154358000 18:13637039-13637061 CTTTGCAAGGCCAAGGTGAGTGG - Intronic
1155777892 18:29791336-29791358 CTTTGCAAGGCCAAGGTGAGAGG - Intergenic
1156242238 18:35265869-35265891 CTGACCAAGACCAAGGAGAAAGG + Intronic
1157010263 18:43639798-43639820 CTGTTCGAGGTCAAGGTGAAAGG + Intergenic
1157700683 18:49760028-49760050 CTGTGCAAGGTCAGGGGGCAGGG + Intergenic
1158688229 18:59634242-59634264 CTCTGCAAGGGGAAGCAGCAGGG + Intronic
1158778839 18:60621757-60621779 CTTTGGGAGGCCAAGGAGAATGG + Intergenic
1159685115 18:71409615-71409637 CTGTGAAAAAGCAATGAGAATGG - Intergenic
1160015169 18:75134760-75134782 ATGTGCAAGGGCCAAGACAATGG - Intergenic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161513451 19:4683968-4683990 ATGTGCAAGGGCACAAAGAATGG + Intronic
1162104499 19:8362214-8362236 CAGAGCACTGGCAAGGAGAAGGG - Intronic
1162618307 19:11819641-11819663 CTTTGGAAGGCCAAGGCGAACGG - Intronic
1162659372 19:12157008-12157030 CTGTGCAAGACAAAGGAGCAGGG - Intergenic
1162821364 19:13225449-13225471 CTGTGCAATGGCAGGGGGAAGGG + Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1162945459 19:14040575-14040597 CTGTGGGAGGCCAAGGAGAGTGG + Intronic
1166582972 19:43918963-43918985 CTGTGAAAAGGCAAGGACATAGG + Intronic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167586489 19:50378403-50378425 CTGCGCAAGTGCAAGGAGGCAGG + Exonic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167849957 19:52193866-52193888 CTTTGGAAGGCCAAGGTGAAAGG + Intronic
1168427828 19:56253122-56253144 CTCTGCAAGGGAAAGGAACAGGG - Intronic
924963720 2:57321-57343 CTGTGCAAGGGTAGGGTGCAGGG - Intergenic
925305998 2:2848810-2848832 CTGAGCAAGGCCAAGGAGAGAGG + Intergenic
925406180 2:3606591-3606613 CTGTCCCAGAGCAAGGAGCAGGG - Intronic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
926436535 2:12844202-12844224 CTGTGCAAGAGCGTGGACAATGG + Intergenic
927273427 2:21239186-21239208 CTGTGTAAGGGAATTGAGAAGGG + Intergenic
927692588 2:25218852-25218874 GTGTCCAAGGGCAAGGAGAAGGG - Intergenic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
928150135 2:28819738-28819760 CTGTGGAAGGCCAAGGCGAGAGG + Intronic
930256351 2:49097429-49097451 CAGTGCAAGGCCAAGATGAAAGG + Intronic
931179129 2:59882379-59882401 ATCTGCAAGGGCATGGAGACTGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932206116 2:69884526-69884548 ATGTGCAAGGGCAAGAAGCGAGG - Intergenic
932470527 2:71952222-71952244 CTGAGATAGGTCAAGGAGAAGGG + Intergenic
934322811 2:91983357-91983379 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
934461121 2:94214153-94214175 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
934736285 2:96691448-96691470 CTGGCCAAGGGCGAGGAGGAGGG + Intergenic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935269233 2:101419420-101419442 CTGTGGAAGGAAAAGGAGACTGG + Intronic
935788269 2:106568522-106568544 CTGTTCATGGGCCAGGAAAATGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
935996407 2:108778971-108778993 CTGTGCAAGGCCAAGGTGGCAGG - Intronic
937509445 2:122577570-122577592 CAGTGAAAGGGCAAGCAGAGAGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938311864 2:130295897-130295919 CTTTGCAACGGGAAGGGGAAGGG - Intergenic
938368940 2:130756649-130756671 CTGCCCAGGGGCAAGGAGATGGG - Intronic
938891825 2:135712956-135712978 CTTTGGGAGGCCAAGGAGAAAGG + Intronic
939155698 2:138522663-138522685 ATGTGCAGGGGCAAGAAGAGGGG - Intronic
939480891 2:142745786-142745808 CTTTGAGAGGGCAAGGTGAAAGG + Intergenic
940132177 2:150394483-150394505 CTTTGAAAGAGCAAGCAGAATGG + Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
941735143 2:168965959-168965981 ATGTGCAAGAGCAAGGAAGAGGG - Intronic
941955407 2:171199265-171199287 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
942075404 2:172352690-172352712 CTGAGCCAGGGGAAGAAGAAAGG + Intergenic
943155477 2:184169598-184169620 ATGTCCAAGGGCAGGGGGAATGG - Intergenic
944533625 2:200688470-200688492 CTTGGCAAGGGTGAGGAGAAAGG - Intergenic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945706702 2:213243571-213243593 ATGTGCCAAGGCAAGGGGAAGGG + Intergenic
945777451 2:214124860-214124882 CAGCCCAAGGGCAAGGTGAAAGG - Intronic
946303794 2:218843943-218843965 CTTTGCAAGGCCAAGGAGGGTGG + Intergenic
946353269 2:219169279-219169301 CAGAGCAAGGGCAAGGGGTAAGG - Exonic
946428157 2:219610701-219610723 AGGTGCAAGTGAAAGGAGAATGG - Intronic
946459554 2:219856940-219856962 CTGTGCCCTGGCAAGGAGTAGGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947477471 2:230463795-230463817 ATGTGGAATGGCAAGCAGAAGGG + Intronic
947880654 2:233508072-233508094 CTGGGCAAGGGCAGGGAAAGTGG - Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948692938 2:239718437-239718459 CAGTGGCAGGGCCAGGAGAAGGG - Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948888235 2:240894395-240894417 CTGTGCAGGGGCCAGGATGATGG - Intronic
1171057768 20:21924263-21924285 CTGTGCAAGATTAAGGAGATGGG - Intergenic
1171893782 20:30742133-30742155 ATGTCCAAGGGCAGGAAGAAGGG + Intergenic
1172370415 20:34385304-34385326 CTTTGCAAGGCCAAGGTGAGCGG - Intronic
1172691529 20:36793673-36793695 CTGCACCAGGGCAAGCAGAACGG - Exonic
1172873004 20:38147423-38147445 CTGTGCAAAGGCCCTGAGAAGGG - Intronic
1174316419 20:49705934-49705956 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1174367159 20:50063629-50063651 CTGTACAAGGGCAAAGACAGGGG - Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1176420170 21:6507824-6507846 ATGTCCAAGGGCAGGGGGAACGG - Intergenic
1176619988 21:9049230-9049252 ATGTCCAAGGGCAGGAAGAAGGG - Intergenic
1177276909 21:18923742-18923764 CTGTGAAAGTGGAATGAGAATGG - Intergenic
1177382206 21:20359523-20359545 CTTTGGGAGGCCAAGGAGAAAGG + Intergenic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179695662 21:43116144-43116166 ATGTCCAAGGGCAGGGGGAACGG - Intergenic
1180549571 22:16529255-16529277 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1181355121 22:22292573-22292595 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1182692768 22:32175586-32175608 CTGGACCAGGGCTAGGAGAAAGG - Intergenic
1182764691 22:32750350-32750372 CAGGGCAAGGGCAAGGGCAATGG + Intronic
1183056272 22:35308086-35308108 CTGTCCAAGTGCAAGGACAAGGG - Intronic
1183269166 22:36850017-36850039 CTGTGGCAGGCCAAGGAGACAGG + Intergenic
1183444962 22:37847450-37847472 CTGTGCCAGGCCTCGGAGAAGGG + Intronic
1183583063 22:38737088-38737110 CTTTGCAAGGCCAAGGCGAGGGG - Intronic
1183828219 22:40404838-40404860 CTGTGGAAGGGCTTGGAGATGGG + Intronic
1184030775 22:41893094-41893116 CTGTGGAAGGACAAGGACCAGGG - Intronic
1184143943 22:42597276-42597298 CTGACCCAGGGCAGGGAGAAAGG + Intronic
1184270387 22:43377999-43378021 CTTTTCAAGGGCCAGGAGGAAGG - Intergenic
1184353620 22:43962973-43962995 CTCTGGGAGGCCAAGGAGAAAGG - Intronic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1185419892 22:50729338-50729360 CTGGGCAGGGGCAGGGAGAGGGG + Intergenic
949483740 3:4518160-4518182 CTGTGCACAGTCAAGGAGGAGGG - Intronic
949703089 3:6781609-6781631 ATCTGAAAGGCCAAGGAGAATGG + Intronic
950071835 3:10158810-10158832 CTTTGGAAGGCCAAGGAGAGAGG - Intergenic
950158338 3:10740599-10740621 CAGTGCAAAGGCCTGGAGAAGGG - Intergenic
950589331 3:13924958-13924980 CTCTGCTAGGGCAATGGGAAAGG + Intergenic
950734873 3:14998766-14998788 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
951444686 3:22764930-22764952 CTGTAAAAGGACAAAGAGAAAGG - Intergenic
952297482 3:32074068-32074090 CTGTGTAAGAGCAGGAAGAAAGG - Intronic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
954259575 3:49428986-49429008 ATTTGCAAGGGCAAGGAAGACGG + Intronic
954374601 3:50187684-50187706 ATCTGCAGGGGCAAGGAGAGGGG - Exonic
954794795 3:53155997-53156019 CTGTCCCAGGGCAAGGATTAGGG + Intronic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956343633 3:68253316-68253338 GTACGCAAGGGCAAGGAGATGGG - Intronic
956933186 3:74069663-74069685 TTGTTCAAGGGCATGGAGTAAGG + Intergenic
957750406 3:84407949-84407971 ATGTCCAAGGGCAGGAAGAACGG + Intergenic
958813808 3:98893835-98893857 CTGTGCAAGGATTAGGAGCAGGG + Intronic
960404595 3:117244424-117244446 CTGACCAAGGACAATGAGAAAGG - Intergenic
960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG + Intronic
960687391 3:120307719-120307741 CTGTGCCAGATCAAGGACAATGG + Intergenic
961471554 3:127116306-127116328 TTGGGTAACGGCAAGGAGAAAGG - Intergenic
962182374 3:133221477-133221499 TTGTGCAATGACTAGGAGAAGGG + Intronic
962616539 3:137131969-137131991 CTGTGCAGGAGAGAGGAGAAAGG - Intergenic
962660067 3:137593018-137593040 CTGTTCAAGGGCCATGATAAAGG + Intergenic
963786825 3:149543337-149543359 CTTTGGAAGGCCAAGGCGAACGG + Intronic
964565472 3:158046585-158046607 CTTTGGGAGGCCAAGGAGAAAGG + Intergenic
965496587 3:169405874-169405896 TTGAACAAGGGTAAGGAGAAGGG + Intronic
966077428 3:175954728-175954750 AGGTGCAAGGAGAAGGAGAAAGG + Intergenic
967136446 3:186516606-186516628 CTTTGGAAGGGCAAGGAGTGTGG - Intergenic
968344690 3:197991729-197991751 CTGTACAAAGTCAAGGAAAAGGG - Intronic
968412433 4:401688-401710 CTGTGTAAGAGCAGGAAGAAAGG + Intergenic
969291322 4:6241786-6241808 GTGTGCAAAGGGAAGGAGATTGG + Intergenic
969523967 4:7694859-7694881 CTGTCCAAGGGAAAGGGGACTGG - Intronic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
969713514 4:8857813-8857835 CTGGGCAGGGGCAAGGGCAAGGG - Intronic
969844240 4:9907535-9907557 GTTTGCAAGGCAAAGGAGAAAGG - Intronic
970050239 4:11906015-11906037 GAGTGCAAAGGCCAGGAGAATGG - Intergenic
970405917 4:15764136-15764158 CTGTGCATGTGTAGGGAGAAGGG + Intergenic
970434737 4:16022396-16022418 CTTTGCAGGGTCAAGGAGAAAGG + Intronic
970549732 4:17167162-17167184 ATGGGCAAAGGCAAGGGGAAGGG - Intergenic
970819583 4:20197051-20197073 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
971327243 4:25654743-25654765 CTGTGCAAGGGGAAGGACTCGGG - Intergenic
971652402 4:29295038-29295060 CAGTGCAAGGGCTAGGAATAAGG + Intergenic
972591737 4:40494510-40494532 CTGTGGGAGGGCAAGGAACAAGG + Intronic
972942793 4:44217746-44217768 ATGTCCAAGGGCAGGAAGAATGG - Intronic
973339531 4:48989665-48989687 CTGTGGGAGGCCAGGGAGAATGG - Intronic
973756526 4:54079852-54079874 GTCTGCAAGGGTATGGAGAAAGG + Intronic
975652034 4:76603173-76603195 CTTTGGAAGGCCGAGGAGAACGG + Intronic
976051137 4:81012537-81012559 CTCTGCTAGGGCAAGGCAAAAGG + Intergenic
977134079 4:93280248-93280270 CAGTGCAATGGCAGGAAGAAAGG - Intronic
977625503 4:99185728-99185750 ATGTCCAAGGGCAGGAAGAATGG - Intergenic
978920273 4:114175310-114175332 CTCTGCTAGGGCAATGTGAAAGG - Intergenic
979608346 4:122663364-122663386 CTATGCAAAGGAAAGAAGAAGGG + Intergenic
981135538 4:141206957-141206979 ATGTCCAAGGGCAGGAAGAATGG + Intronic
981812208 4:148788994-148789016 CAGTGCTGGGGCAATGAGAAAGG + Intergenic
981866308 4:149423556-149423578 CTTTGCAAGGGAGAGGAGCATGG - Intergenic
985159154 4:187026162-187026184 GTGTGCAGGGGCATTGAGAAGGG - Intergenic
985304330 4:188522139-188522161 CTCTGCTAGGGCAATGTGAAAGG + Intergenic
1202771190 4_GL000008v2_random:209118-209140 ATGTCCAAGGGCAGGAAGAAGGG + Intergenic
985988930 5:3539166-3539188 CAGGGCAAGGGCAAGGACAAGGG - Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986311099 5:6551723-6551745 CTGGGCAAAGGCGTGGAGAAGGG - Intergenic
986514701 5:8548886-8548908 ATTGGCAAGGGCAAGTAGAAGGG + Intergenic
987541453 5:19261223-19261245 CTGTGCTAGGGCAGTGTGAAAGG + Intergenic
990448710 5:55916479-55916501 CTGTGGAAGGGCATGCAGAGAGG + Intronic
990667759 5:58092950-58092972 GTGTGCAAAGGCATGGAGACAGG - Intergenic
990701050 5:58475328-58475350 CTCTGCTAGGGCAATGGGAAGGG - Intergenic
991288996 5:65012771-65012793 CTCTGAAGGGGCAAGGACAAAGG + Intronic
991297870 5:65100969-65100991 ATGGGGAAGGGCAAGGAGAGAGG - Intergenic
991413151 5:66365259-66365281 CTTTGGGAGGCCAAGGAGAATGG + Intergenic
992207872 5:74448596-74448618 TTGTGCTATGGGAAGGAGAAAGG + Intergenic
992414518 5:76539651-76539673 CCATGCAAGGACAAGGAGAAAGG - Intronic
993711550 5:91230284-91230306 CTCTGCTAGGGCAATGTGAAAGG - Intergenic
995132184 5:108642352-108642374 CTGAGCTATGGCAGGGAGAATGG - Intergenic
996309535 5:122088901-122088923 CTATGTAAGGGCAAAGAGAAGGG - Intergenic
997157919 5:131578343-131578365 CTGTGTAAGAGCAGGAAGAAAGG - Intronic
997835147 5:137186179-137186201 CTGTGAAAGGACAATGAGAGAGG - Intronic
998357347 5:141551204-141551226 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
998697078 5:144652691-144652713 CTCTGCTAGGGCAATGTGAAAGG - Intergenic
999250977 5:150182161-150182183 CTGTGCAAGAGAAGAGAGAAGGG - Intronic
1000317951 5:160111074-160111096 CTGTGGGAGGGCAAGGAGGGAGG + Intronic
1000777854 5:165442079-165442101 CTGTGCTAGGGCAATGTGGAAGG - Intergenic
1000880744 5:166694046-166694068 CTGTGCAAGGGAAAATAGATGGG - Intergenic
1001181647 5:169526111-169526133 CTGTGCTAGGGCAATGTGGAAGG - Intergenic
1001211688 5:169815758-169815780 CTGTGCAGGGGCCAGGACTAGGG - Intronic
1001855070 5:175003830-175003852 CTGTGGAAGGGAGAGGAGACTGG + Intergenic
1001877914 5:175216947-175216969 CTGTGCCAAGGCAGGGAGATGGG + Intergenic
1002947984 6:1780922-1780944 ATGTGAAAGGAAAAGGAGAAGGG - Intronic
1003337276 6:5185904-5185926 CTGGGCCAGGGCCAGCAGAAGGG + Intronic
1003355485 6:5365593-5365615 CTCTGGAAGGCCAAGGCGAAAGG - Intronic
1003432584 6:6053435-6053457 ATGGGAAAGGGAAAGGAGAATGG + Intergenic
1003494669 6:6653722-6653744 CTGAGCAACTGGAAGGAGAAAGG - Intronic
1003954539 6:11149651-11149673 CTGTGCAGGGACTAGGATAAGGG - Intergenic
1005088191 6:22028333-22028355 CTCTACAAGAGCAAGGAAAAGGG - Intergenic
1005316381 6:24606530-24606552 CTGTGCCAGGACATGGACAAGGG + Intronic
1005677497 6:28170181-28170203 GAGTGCAAGGCCAAGGAGGATGG - Intergenic
1006083136 6:31579025-31579047 CTTTGCAAGGCCAAGGTGAGAGG + Intergenic
1006152189 6:31995545-31995567 GGGTGCAAGGGCAAGCAGGAGGG + Intronic
1006158491 6:32028283-32028305 GGGTGCAAGGGCAAGCAGGAGGG + Intronic
1006317769 6:33300234-33300256 GTGAGCCAGGGCAAGAAGAATGG + Intronic
1007279578 6:40700700-40700722 CTGGGCAGGTGCAAGGAGCAGGG + Intergenic
1007466869 6:42058662-42058684 CTGACCAAGGGCAAGGGCAAGGG - Intronic
1007492110 6:42231210-42231232 TTGTGGAAGGGCAAAGAGAGGGG - Intronic
1007808892 6:44472557-44472579 CTAGGCACGGGCAAGGAGCAAGG - Intergenic
1008242256 6:49127714-49127736 CTGTGCAAGGGCAGTGTGGAAGG + Intergenic
1009423315 6:63487211-63487233 CTTTGGGAGGCCAAGGAGAATGG - Intergenic
1009609182 6:65916881-65916903 CTTTGGAAGGCCAAGGTGAAAGG - Intergenic
1010064368 6:71663904-71663926 GTGTGTAAGGGTATGGAGAAGGG - Intergenic
1010631796 6:78207442-78207464 CTCTGCTAGGGCAATGAGGAAGG - Intergenic
1011647252 6:89471656-89471678 CTGAGCAAAGTTAAGGAGAAAGG + Intronic
1012706573 6:102539036-102539058 CTCTGCCAGGGCAATGTGAAAGG + Intergenic
1012958758 6:105599624-105599646 CAGTGAAAGGGAAAGGGGAAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014055239 6:117007070-117007092 ATCTACAAGGGCAAAGAGAATGG + Intergenic
1015783095 6:136891886-136891908 CTTTGCAAGGGCAAGGCGGGTGG - Intronic
1016749545 6:147617718-147617740 CAGGGCTAGGGCTAGGAGAAAGG + Intronic
1016790201 6:148060004-148060026 CTCTGCAAGGGCAATGTGAAAGG - Intergenic
1017231378 6:152077392-152077414 CTCTGCTAGGGCAATGAGGAAGG + Intronic
1019028619 6:168992041-168992063 GTGAGCATGGGCAAAGAGAACGG - Intergenic
1020579406 7:9976068-9976090 CTGTGAAAGGCCAAGGTGAGCGG - Intergenic
1020936623 7:14473471-14473493 CTCTGCTAGGGCAATGAGGAAGG + Intronic
1020944488 7:14584901-14584923 CTTTGGGAGGCCAAGGAGAATGG - Intronic
1021323464 7:19239726-19239748 CTCTGCTAGGGCAATGAGAAAGG - Intergenic
1021927358 7:25546244-25546266 CTATGCCAGGGCAAGGAGGAGGG + Intergenic
1022115058 7:27253634-27253656 CTGTGTAAGAGAAAGGAGATGGG + Intergenic
1022470484 7:30679091-30679113 CTGAGCAAAGGCAAGGAGACAGG - Intronic
1023410528 7:39885317-39885339 CTGTGCAAGGTCCTAGAGAAAGG - Intergenic
1023458567 7:40368438-40368460 CTTTGGGAGGGCAAGGAGGAGGG - Intronic
1023604105 7:41911998-41912020 ATGTGAAATGGCAAGTAGAATGG - Intergenic
1023771117 7:43557437-43557459 ATGTGTGAGGGCCAGGAGAAAGG + Intronic
1024102887 7:46050877-46050899 CAGTGCTAGTGCAGGGAGAAGGG + Intergenic
1024228936 7:47349487-47349509 CTCTGCAAGCGCAGGAAGAATGG + Intronic
1025124901 7:56336648-56336670 TTGTGGGAGGCCAAGGAGAAAGG - Intergenic
1025987698 7:66469507-66469529 CTGGGCGAGGGCATAGAGAATGG - Intergenic
1026003988 7:66586397-66586419 CTGGGCGAGGGCATAGAGAATGG - Intergenic
1026027249 7:66755630-66755652 CTGGGCGAGGGCATAGAGAATGG + Intronic
1026215711 7:68347059-68347081 CTTTGCAAGGTCAAGGCGAGTGG - Intergenic
1026277194 7:68890350-68890372 CTTTGGAAGGCCAAGGAGAGAGG - Intergenic
1026322952 7:69283472-69283494 CTATCCAAGGGCAAGGATACTGG - Intergenic
1026447612 7:70499240-70499262 CTGCTGAAGGGAAAGGAGAAGGG + Intronic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026741557 7:72981859-72981881 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026801391 7:73402243-73402265 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026827795 7:73595200-73595222 CCGTGGAGGGGCAAGGAGGAGGG - Intronic
1027056016 7:75050029-75050051 ATGTGCAAGAGGAAGGACAATGG + Intronic
1027102178 7:75383219-75383241 CTCTGAAAGGGGAGGGAGAAGGG - Intergenic
1027200440 7:76060822-76060844 GTTTTCAGGGGCAAGGAGAAAGG - Intronic
1027210685 7:76145414-76145436 CTGGGCGAGGGCATAGAGAATGG - Intergenic
1027385347 7:77654347-77654369 CTGTGGAAAGGAAAAGAGAAGGG - Intergenic
1027401535 7:77813531-77813553 CTGTGAAAGGGAGAAGAGAAAGG + Intronic
1028432028 7:90758810-90758832 CTTTGCAAGGGCAAGGCGGGTGG + Intronic
1029093825 7:98069503-98069525 CTTTGCAAGGCCAAGGAGGGTGG + Intergenic
1030328417 7:108246848-108246870 CTATGCAAGGGCATGGATACTGG - Intronic
1030333143 7:108294640-108294662 TTGTGCAATGGGAAGGAAAATGG + Intronic
1030870307 7:114747521-114747543 CTGTGCAGAGCCAAGGAAAATGG + Intergenic
1030902399 7:115140615-115140637 TCGTGGAAGGGGAAGGAGAACGG - Intergenic
1031175066 7:118339261-118339283 CTCTGCTAGGGCAGTGAGAAAGG + Intergenic
1031684484 7:124716466-124716488 CTTTGGGAGGCCAAGGAGAAAGG + Intergenic
1032031203 7:128485287-128485309 CTTTGGAAGGCCAAGGAGATAGG + Intronic
1032278844 7:130485188-130485210 ATGTGTAAAGGCACGGAGAAAGG + Intergenic
1032463456 7:132128520-132128542 ATGAGCAAGGGGAAAGAGAAGGG + Exonic
1034011937 7:147538406-147538428 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
1034384785 7:150731971-150731993 GTGTGGAAGGGAAAGGAAAAAGG - Intronic
1034410465 7:150938752-150938774 CTGTGGGAGGACAAGGAAAAAGG + Intergenic
1037584912 8:20269642-20269664 GCATGCATGGGCAAGGAGAAGGG + Intronic
1037832445 8:22197475-22197497 GGGTGCAGGGGCAGGGAGAAAGG - Intronic
1040401585 8:47055402-47055424 CTCTGCAAGGCCAAGGTGAGTGG + Intergenic
1042069706 8:64917763-64917785 ATTTGCAAGGAGAAGGAGAAAGG - Intergenic
1043518243 8:81016690-81016712 ATTTTAAAGGGCAAGGAGAAAGG - Intronic
1045105137 8:98885219-98885241 CTGTGCTGGGGCAAGGAGGCAGG - Intronic
1045222336 8:100211410-100211432 CTTTGGAAGGCCAAGGAGAGAGG + Intronic
1046973358 8:120247178-120247200 CTTTGGGAGGCCAAGGAGAATGG + Intronic
1048672206 8:136735714-136735736 CTGAGCATAGGCAAGGGGAAGGG - Intergenic
1049161589 8:141101671-141101693 GTGGGGAAGGGCACGGAGAAGGG - Intergenic
1049670842 8:143869220-143869242 CTGTGGCAGGCCATGGAGAAGGG - Exonic
1049905140 9:209437-209459 TTGTGCAAAGGCAGGGAGACAGG - Intergenic
1050426660 9:5518362-5518384 CCGTGGAAGGGCAAGGAAGAAGG + Intronic
1051029546 9:12658116-12658138 CTTTCCAAGGGCAAGCAGAGTGG + Intergenic
1051619532 9:19036753-19036775 CTCTGCTAGGGCAATGTGAAAGG + Intronic
1051957117 9:22709704-22709726 TGGTGAAAGGGCAAAGAGAAGGG + Intergenic
1052103102 9:24475364-24475386 CTATTCAAAGGCAAGGAGATGGG + Intergenic
1052173334 9:25427816-25427838 CTCTGCAATGGCAGGTAGAAGGG - Intergenic
1052365343 9:27606469-27606491 CTTTGTAATGGTAAGGAGAAAGG - Intergenic
1052688251 9:31780952-31780974 ATGTGCTAGGGCAATGAGGAAGG - Intergenic
1052691671 9:31822913-31822935 CTGTGCAAGAGCAAAGAGTATGG - Intergenic
1053691605 9:40589813-40589835 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054273197 9:63047672-63047694 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1054302861 9:63390779-63390801 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054354849 9:64050558-64050580 ATGTCCAAGGGCAGGAAGAAGGG - Intergenic
1054401642 9:64717295-64717317 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054435245 9:65201604-65201626 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054495145 9:65820077-65820099 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1055295177 9:74826619-74826641 CTGGAGGAGGGCAAGGAGAAGGG - Intronic
1055676132 9:78663434-78663456 GTGGGAGAGGGCAAGGAGAAAGG + Intergenic
1057374191 9:94503695-94503717 CTGTACATAGGCAAGGAAAAGGG - Intergenic
1057759163 9:97858988-97859010 TTCTGCAAGGGCCAGGAGCAAGG + Intergenic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1057929944 9:99184701-99184723 CTGTGCCAGAGACAGGAGAAGGG + Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1059098705 9:111447871-111447893 CTGTGAAAGGACAAGGGAAAAGG - Intronic
1059132226 9:111765352-111765374 CTTTGCGAGGCCAAGGTGAAAGG + Intronic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1060274068 9:122169020-122169042 ATGTCCAAGGGCAAGGAAGATGG + Intronic
1060471661 9:123952856-123952878 ATGTGAAAAGGCAAGGAGAGGGG - Intergenic
1060505138 9:124192049-124192071 CTGAGCAGGGGCCAAGAGAAAGG + Intergenic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061361873 9:130148666-130148688 CTTTGGAAGGCCAAGGAGAGAGG - Intergenic
1061385905 9:130289284-130289306 CTGTGCATCTGCTAGGAGAAAGG + Intronic
1061572908 9:131488643-131488665 CTGCACAAGGGCAGGGAGAAAGG - Intronic
1062379552 9:136280715-136280737 CAGTGCCAGGGGGAGGAGAAGGG - Intergenic
1062652146 9:137583466-137583488 CAGGTCAAGGGCAAGGAGAGGGG - Intronic
1203743187 Un_GL000218v1:19688-19710 ATGTCCAAGGGCAGGAAGAAGGG - Intergenic
1203566917 Un_KI270744v1:99827-99849 ATGTCCAAGGGCAGGAAGAAGGG + Intergenic
1185906491 X:3938739-3938761 GTGTGCAAGGGCAAGTGTAAAGG + Intergenic
1186051878 X:5604927-5604949 CTTTGGAAGGCCAAGGCGAAAGG + Intergenic
1186585499 X:10869017-10869039 CTGTCCAATGGCAAGGGGATTGG - Intergenic
1187042998 X:15616749-15616771 CTGACCAAGGGCAAGGACATGGG + Intergenic
1188535737 X:31194776-31194798 CTGTGAAAGGGACAGGACAATGG + Intronic
1189498264 X:41529334-41529356 CTGTGCAAGGGCAAGGAGAAAGG + Intronic
1190356084 X:49606444-49606466 CTTTGAAAGGCCAAGGAGAGTGG - Exonic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1192043036 X:67643439-67643461 CTCTGGAAGGTAAAGGAGAAAGG - Intronic
1192442995 X:71188797-71188819 CTGTGAGAGGTCAAGGTGAATGG + Intergenic
1192844496 X:74891874-74891896 CTGTGAAAGGGTGAGGGGAAAGG - Intronic
1197055101 X:122109247-122109269 CTGTGCCATGGCAATGTGAAAGG + Intergenic
1197887014 X:131229062-131229084 CTGTGCAAGTGCTAAGAAAAAGG + Intergenic
1197892185 X:131278800-131278822 GGGTTCAAGGGCAAGGAGGAGGG - Intronic
1198297280 X:135300303-135300325 AAGTGCAGGGGCAAGGACAAGGG - Intronic
1198575464 X:138005693-138005715 CTGTGCAAGGGAAGGCATAAAGG - Intergenic
1199596605 X:149510929-149510951 CTGGGCTTGGGTAAGGAGAAGGG + Intronic
1199895649 X:152125121-152125143 CTGTGCATGTGCATGGAGAGAGG - Intergenic
1200016946 X:153172186-153172208 CTGTGCATGTGCATGGAGAGGGG + Intergenic
1200892422 Y:8338049-8338071 CTAGGCAAGGGCTAGGAAAAGGG - Intergenic
1201190307 Y:11438533-11438555 CAGTGCCTGGGCAAGGACAAGGG - Intergenic
1201540478 Y:15100491-15100513 CTGTGTAAGTGCAGGAAGAAAGG + Intergenic
1202583316 Y:26403382-26403404 CAGTGCCAGGGCAAGGACAAGGG + Intergenic