ID: 1189499432

View in Genome Browser
Species Human (GRCh38)
Location X:41542090-41542112
Sequence ACATACATACTATAAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189499432 Original CRISPR ACATACATACTATAAAGGGA AGG Intronic
900691785 1:3985156-3985178 GCTTACATCCTATGAAGGGAGGG - Intergenic
901365241 1:8742072-8742094 ATATACATACTACACTGGGATGG - Intronic
904580643 1:31541339-31541361 ACATGCAAACCATACAGGGAGGG + Intergenic
908392729 1:63698323-63698345 ACATACACTCTAGAAGGGGAAGG + Intergenic
912037585 1:105339747-105339769 ACACACATAATATAAAAGGCTGG + Intergenic
913456722 1:119039733-119039755 ACAAACATAATAGAAAGGAATGG - Intronic
913998545 1:143672574-143672596 ACATACATATCTCAAAGGGATGG - Intergenic
916919423 1:169447858-169447880 ACATATATAGATTAAAGGGATGG - Intronic
919477537 1:198047750-198047772 ACATACAAATAAGAAAGGGAAGG - Intergenic
920541305 1:206780163-206780185 ACATAAATACTACAGAGGGGTGG - Intergenic
922355357 1:224769987-224770009 TACTACATACTATAAAGTGAGGG - Intergenic
924894348 1:248319196-248319218 ATAAACTTACTATAAAGGGGTGG + Intergenic
1064235530 10:13570624-13570646 ACAGACATGCTAAAAAAGGAAGG + Intergenic
1065007326 10:21392028-21392050 ACTCACATACTATTAAGGGCTGG - Intergenic
1066473049 10:35717885-35717907 ACAAAGATATTATAAAGAGATGG + Intergenic
1067422595 10:46168150-46168172 AAATACATACAATACAGGGCAGG - Intergenic
1068124039 10:52815986-52816008 ACACACATACCATATAGGGAAGG + Intergenic
1068815656 10:61308322-61308344 ACATACATACTTTAAATACAAGG - Intergenic
1070896672 10:79988751-79988773 ACATAGATAAAATAAAGGGATGG + Intergenic
1071145069 10:82559289-82559311 ACCTACACAAGATAAAGGGAAGG + Intronic
1072284991 10:93905617-93905639 ACATACTTGGTATCAAGGGAGGG + Intronic
1073377505 10:103049172-103049194 ACACACATGCAGTAAAGGGAAGG - Intronic
1073553458 10:104425544-104425566 ACATACATAACATAAAGGATTGG - Intronic
1074928406 10:118097782-118097804 ACATACATATTAAAAAAGGAGGG + Intergenic
1075278522 10:121118127-121118149 ACAGATATACTGTAGAGGGAGGG + Intergenic
1075704916 10:124494785-124494807 ACAGACAAACTTTAAAGGGCAGG - Intronic
1077471531 11:2763584-2763606 ATATACATATTTTAAAGGCAGGG + Intronic
1079483656 11:20910934-20910956 GCTTAAATACTAAAAAGGGATGG - Intronic
1080118958 11:28653504-28653526 ACATAAATAATGTAAAGGGTAGG + Intergenic
1080233923 11:30047040-30047062 ACATACACAGTATACAGGCACGG - Intergenic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1086382173 11:86267180-86267202 AAATACATACTATAATTGTATGG - Intronic
1086831744 11:91574702-91574724 ACATATATAATATATAGAGAAGG - Intergenic
1088501607 11:110489081-110489103 ACTTATATACTATATAGGAAAGG + Intergenic
1088652254 11:111968162-111968184 ATATAAATTCTATGAAGGGAGGG + Intronic
1089037865 11:115414686-115414708 AAACACTTACAATAAAGGGAAGG + Intronic
1093491224 12:19707003-19707025 AATTGCATACTATAAAGGGTGGG - Intronic
1094262163 12:28513146-28513168 ACATGCAAACTATAAAAGAAGGG + Intronic
1097519365 12:60648044-60648066 ACATAAATTCTATAATGAGAAGG + Intergenic
1097574793 12:61378488-61378510 ACATACATATTTGGAAGGGAAGG - Intergenic
1099380648 12:81948057-81948079 AGATACATATAATAAAGTGAAGG + Intergenic
1100546072 12:95603881-95603903 ACATACATACTAGATAGGGCTGG + Intergenic
1101748852 12:107565908-107565930 ACATTGGTACTATATAGGGAAGG - Intronic
1105568880 13:21580357-21580379 ACATACATACTTTTAAGGGTAGG + Intronic
1105679153 13:22707516-22707538 ACATTCATTCTGTAAAGGAAGGG + Intergenic
1106285140 13:28312156-28312178 CCTTACGTACTACAAAGGGAGGG + Intronic
1107185919 13:37519996-37520018 ACATACATAGTATTAATAGATGG - Intergenic
1108232968 13:48369827-48369849 GGATACATGCTATAAAGGAATGG - Intronic
1109531697 13:63657802-63657824 ACAAATATACTATAAATGGAAGG + Intergenic
1110448478 13:75615588-75615610 ACAGACTAAATATAAAGGGATGG - Intergenic
1111897024 13:94154842-94154864 AGATACATACTTTAAAAGAATGG - Intronic
1112203041 13:97296736-97296758 ACATACATACTAGAAAATGAGGG + Intronic
1112377067 13:98852949-98852971 ATATACACACTCTAAATGGAAGG + Intronic
1112681531 13:101771819-101771841 ATATACATACTTTAAAGGAGAGG + Intronic
1116884467 14:50206219-50206241 ACATACATATTAGAAAAGAAAGG - Intronic
1117431113 14:55662445-55662467 ACATTTATACTAGAAAGGGAAGG + Intronic
1117484024 14:56175744-56175766 TCATATCTAATATAAAGGGAGGG - Intronic
1118178617 14:63468307-63468329 CCAGACATACCAAAAAGGGAGGG - Intronic
1120581230 14:86252489-86252511 ACATTGATAATAAAAAGGGAGGG + Intergenic
1124162121 15:27281690-27281712 ACAAACATATTATAAAAGAAAGG - Intronic
1125461910 15:39915481-39915503 ACATTCAGTCTATAAAGGAAAGG + Intronic
1126826543 15:52556295-52556317 AATTACTTACTATACAGGGAAGG - Intronic
1128681499 15:69655679-69655701 ACATACATACATAAAAGGAAGGG - Intergenic
1129698930 15:77756550-77756572 ACATACATACCATCAAGGGAGGG + Intronic
1131926419 15:97389122-97389144 TCCTACATATTATAAAGGTATGG - Intergenic
1132139152 15:99376429-99376451 ACACACATACTAGAAAAGAAAGG - Intronic
1132276947 15:100575300-100575322 ACAGAAATAAAATAAAGGGATGG + Intronic
1132283306 15:100639812-100639834 ATATAAATACTATAAAGGGCAGG - Intronic
1133672542 16:8037837-8037859 ACTTACAAACTAGAAAAGGAGGG - Intergenic
1134145865 16:11761240-11761262 CCATACATATACTAAAGGGAAGG + Intronic
1135116775 16:19730418-19730440 AGCTTCATACTCTAAAGGGAAGG - Exonic
1139680927 16:68562104-68562126 ACATACATACTAAAAGTGTAGGG - Intronic
1142650547 17:1348392-1348414 ACATAATTTCTTTAAAGGGAGGG - Intronic
1147289021 17:39426469-39426491 ACAAACAAACAATAAAGGGATGG + Intronic
1148367595 17:47068366-47068388 AAATAAATAGTATAAAAGGAAGG - Intergenic
1150578188 17:66448545-66448567 TAATATATACTATAAAGGGTAGG - Intronic
1152127430 17:78455638-78455660 ACATACATAACTTAAAGGTAAGG - Exonic
1153717124 18:7861049-7861071 ACATACAGTGTAAAAAGGGAGGG - Intronic
1153800597 18:8665002-8665024 ACATACATACTACCAAGTGTTGG + Intergenic
1154336957 18:13473706-13473728 ATATACATATTATACAGGGGCGG + Intronic
1154932060 18:21009359-21009381 AGATACATACAATACAGAGATGG - Intronic
1155523792 18:26696177-26696199 GCATAGATACAAAAAAGGGAGGG + Intergenic
1157647239 18:49287388-49287410 TCTTACAAACTAGAAAGGGAAGG + Intronic
1158048249 18:53183368-53183390 AATTACATACCATAAAGGCAGGG - Intronic
1159398025 18:67889997-67890019 CCATATATACTGTCAAGGGAAGG - Intergenic
1159405409 18:67995720-67995742 ACAAACAAGCTATAAAGGGATGG + Intergenic
1164179071 19:22804112-22804134 TTATACATTCTATAAATGGATGG - Intergenic
1166419232 19:42622524-42622546 ACATTCTAACTATAAATGGAAGG + Intronic
924989315 2:298134-298156 ACCTACACACTATAAAGAAAGGG - Intergenic
926646671 2:15297253-15297275 ACATACCGAATATAAAAGGATGG - Intronic
928431778 2:31225945-31225967 AAAAACATACTAGTAAGGGAGGG + Intronic
929182900 2:39062680-39062702 ACATATAGACCAGAAAGGGAAGG + Intronic
929235668 2:39603149-39603171 AAATGCATACTAGAACGGGAGGG - Intergenic
929246134 2:39705746-39705768 ACAAACACACAATAAAGTGATGG + Intronic
933283661 2:80360326-80360348 AAATACATAGTATAGAGAGATGG + Intronic
935680275 2:105629965-105629987 GCATACACACTAAAAAGGGATGG + Intergenic
935835711 2:107050917-107050939 AAATAAATAATATATAGGGAGGG - Intergenic
936783382 2:116062177-116062199 ACATACATTCTAAATTGGGATGG + Intergenic
936909769 2:117578363-117578385 ACACACATAGAATAAAGTGAAGG + Intergenic
938586164 2:132692496-132692518 ATATAAATACCATAAAGGCAGGG + Intronic
940386086 2:153073864-153073886 AAAAACAAATTATAAAGGGAGGG - Intergenic
941460078 2:165760322-165760344 CCAGACCTAATATAAAGGGAGGG + Intronic
944816846 2:203386086-203386108 ACATACATCCTCTGAAGAGAGGG + Intronic
945172319 2:207009636-207009658 ACACACATACTATAGAGAAAAGG + Intergenic
946680333 2:222207948-222207970 ATATACACACTTTAGAGGGAAGG - Intronic
946733939 2:222735428-222735450 ACTTACATACAGTAAAGTGAGGG - Intergenic
947558636 2:231124204-231124226 ACAGACTTACTAAGAAGGGAAGG - Intronic
1170596461 20:17809647-17809669 ACATACAGTCGATAAAGAGATGG + Intergenic
1171506888 20:25644049-25644071 ACATGCTAACAATAAAGGGAAGG + Intergenic
1172381830 20:34500528-34500550 ACATACAGACTGAAAAGGAAGGG - Intronic
1177525004 21:22279362-22279384 ACCTCCATTCTAGAAAGGGAGGG + Intergenic
1180103725 21:45603086-45603108 ACATACAGACTAAAAGGGAAGGG - Intergenic
1181579339 22:23818831-23818853 AAATACATTTTAAAAAGGGAAGG - Intronic
949273642 3:2251844-2251866 ACATAAGTATTATAAAGAGAAGG + Intronic
949817457 3:8073623-8073645 ATATACATATTAGAAAGAGACGG - Intergenic
952302745 3:32118554-32118576 ACATACACACTTAAAAAGGATGG - Intronic
953369039 3:42371769-42371791 CCATGCAGACAATAAAGGGAAGG + Intergenic
953567033 3:44041589-44041611 ATATAAATACTAAAAAGGAAGGG + Intergenic
954755636 3:52838016-52838038 ACAAACACACAAGAAAGGGAAGG + Exonic
955422891 3:58757462-58757484 AAAGACAAACTATAAAGTGAGGG - Intronic
957812201 3:85238247-85238269 ATTTACATTCTATAAAGGAATGG + Intronic
959093400 3:101927744-101927766 AAATATATCCTATAAATGGAAGG + Intergenic
959138422 3:102454436-102454458 ACATCCAGACAAGAAAGGGAAGG - Intronic
960742980 3:120855370-120855392 TCACAGATGCTATAAAGGGAAGG - Intergenic
961841734 3:129719848-129719870 AAATCCAAATTATAAAGGGAAGG - Intronic
961902958 3:130232177-130232199 ACATTCATACCATTAAGGCAAGG + Intergenic
961967755 3:130923936-130923958 ACTCACATAAGATAAAGGGATGG - Intronic
961970009 3:130953064-130953086 ACATACATACGAACAAGTGAGGG - Intronic
962851192 3:139309373-139309395 ACATGCATACTAAGAAGGCAGGG + Intronic
963193331 3:142498406-142498428 ACATACATCCTTTTAAGGAAAGG - Intronic
963999506 3:151753111-151753133 ACATACATACTATCTATGTATGG - Intronic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
971221774 4:24715009-24715031 ACATTCATAATATAAAGTGTGGG - Intergenic
972102777 4:35443610-35443632 TCATACATACTGTCAAGGAATGG + Intergenic
973327687 4:48880029-48880051 ACATACATACTTCCGAGGGAAGG - Intergenic
974768124 4:66374950-66374972 AAATACATGCTATAAAGTGTGGG - Intergenic
977475565 4:97503574-97503596 ACATACATACTAGCCAGGCACGG - Intronic
977836634 4:101652911-101652933 ACATACATACTCAAAAGTGTGGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
981488396 4:145313187-145313209 ACATTCATTCTAGAAAGTGAGGG + Intergenic
982191435 4:152859713-152859735 AAAGACATGCTTTAAAGGGAAGG - Intronic
982899652 4:160981897-160981919 AAATACATATTAGAAGGGGAAGG - Intergenic
983458476 4:167996108-167996130 AAAAACATATTTTAAAGGGATGG - Intergenic
983461508 4:168029883-168029905 ACATACACACTAGAAAGGATGGG - Intergenic
983490154 4:168379905-168379927 ACATACATACTATATAGATAAGG + Intronic
984232941 4:177121228-177121250 ACATTTATACTAAAAATGGAGGG + Intergenic
986038205 5:3961015-3961037 CCATGCATTCTTTAAAGGGAGGG - Intergenic
987055067 5:14183347-14183369 GCATACTTACTATTAAAGGAAGG - Intronic
987870001 5:23603871-23603893 ACATACATAAAATAAATGAAGGG - Intergenic
987933289 5:24429939-24429961 AAATACATACAAAAAAGGGCAGG + Intergenic
989260826 5:39418146-39418168 ATATCCATCCTTTAAAGGGAAGG - Intronic
989286025 5:39700909-39700931 ACATGCTTATTATAAAGGCAAGG + Intergenic
989372957 5:40728946-40728968 CCATACATACTAGGAAGGTAGGG + Intronic
989998508 5:50864132-50864154 ACACACACACTCTCAAGGGAGGG + Intergenic
991709032 5:69388902-69388924 ACTTAAATACTAAAAAGGGCTGG - Intronic
993387037 5:87272291-87272313 AAAAACATATTATAAATGGAGGG - Intronic
993682544 5:90897789-90897811 CCACACATACTCTAAAGGCACGG - Intronic
994336980 5:98578510-98578532 ACATAGATAATAAAAAGGGAAGG - Intergenic
994807518 5:104469521-104469543 CCAAAAATACTATAAAGAGAGGG - Intergenic
995974296 5:118012540-118012562 ACATACATGCTATTCAGGAATGG - Intergenic
1000264681 5:159623595-159623617 ACAAACTTAAGATAAAGGGATGG + Intergenic
1002657588 5:180763055-180763077 ATATAGATATGATAAAGGGAAGG + Intergenic
1004096773 6:12562795-12562817 ATAAACTTAATATAAAGGGATGG + Intergenic
1008009346 6:46447110-46447132 ACATATATACTAAAAGGGAAGGG + Intronic
1008091767 6:47300998-47301020 ACATAAATACTATAAACAAAGGG + Intronic
1008449623 6:51635596-51635618 ACATAGATACTATAAAGCCAGGG + Intronic
1009726892 6:67546666-67546688 ACATACATACTAAAATTGGACGG + Intergenic
1010529141 6:76944766-76944788 ATATACTGACAATAAAGGGATGG + Intergenic
1011184481 6:84659059-84659081 CCATACATATTTTAAAGGTAAGG - Intergenic
1011404314 6:87001897-87001919 ACACACTGACAATAAAGGGATGG + Intronic
1011922921 6:92604187-92604209 ACATACACAAAATAAAGGGACGG + Intergenic
1012567400 6:100675790-100675812 AGAAACATACGGTAAAGGGATGG + Intronic
1012629245 6:101442718-101442740 ACTTTCATGCTATAAAGGTAGGG - Intronic
1017478108 6:154820118-154820140 ACATACATACTATAAAAACAAGG - Intronic
1020932220 7:14412457-14412479 ACATACATAGCAAAAAGGGGAGG + Intronic
1022177824 7:27889060-27889082 ACATAGATACTACAATGAGATGG + Intronic
1022789520 7:33672955-33672977 ACAAACATTCTTTAAAGGGAGGG + Intergenic
1024260342 7:47569554-47569576 ACATACATATTACACAGGGACGG + Intronic
1026400107 7:70001435-70001457 TGATAAAGACTATAAAGGGAAGG + Intronic
1026434953 7:70387998-70388020 ACATACAGAATATGAAGGAATGG - Intronic
1027161088 7:75802813-75802835 ACATACAAACTATCAAGAAACGG - Intergenic
1028105793 7:86876949-86876971 ACATACAAAATGTAAATGGATGG - Exonic
1029047966 7:97651404-97651426 AACCACACACTATAAAGGGAAGG + Intergenic
1030256490 7:107514673-107514695 ATATACATTCTACAAAGGGTAGG + Intronic
1031663100 7:124451856-124451878 ACATATATACAGTAGAGGGAGGG + Intergenic
1032831435 7:135631067-135631089 ACGTACATATGAGAAAGGGAGGG + Intronic
1033845174 7:145423058-145423080 CCACACATATTAGAAAGGGACGG - Intergenic
1036037736 8:5038682-5038704 ACATAAATGCAATAAAGAGAGGG + Intergenic
1037065656 8:14573964-14573986 ACATGCATACACTACAGGGAGGG + Intronic
1038934667 8:32235540-32235562 ACTTACCAACTATAATGGGATGG - Intronic
1039952622 8:42183707-42183729 ACATAAATACCATAAATGGAAGG + Intronic
1040968240 8:53106163-53106185 ACATACAGAATATACAGGGAAGG - Intergenic
1041032221 8:53748679-53748701 AAATACATACTATATATGCATGG + Intronic
1042687524 8:71458928-71458950 AAATACATACTAAAGAGGGCAGG + Intronic
1043055129 8:75428125-75428147 ACTTACATTTTGTAAAGGGAAGG + Intronic
1043672478 8:82904705-82904727 ACATACATACAAAAAAGCCATGG - Intergenic
1043984374 8:86676324-86676346 ACTTTGATAATATAAAGGGAAGG + Intronic
1044437016 8:92176487-92176509 GCATATAGACTATAAATGGATGG + Intergenic
1045167409 8:99622233-99622255 AAATACCTACTTTACAGGGATGG - Intronic
1046413554 8:113880437-113880459 ACATAAACATTTTAAAGGGAGGG + Intergenic
1047678459 8:127228375-127228397 TCACACATACCATCAAGGGATGG - Intergenic
1048345831 8:133573493-133573515 AAATAACTACTAGAAAGGGAAGG + Intergenic
1054972581 9:71105809-71105831 ACACACATACAATACAGTGATGG + Intronic
1055008563 9:71537312-71537334 ACACACATACTGTATAGAGAGGG + Intergenic
1055170380 9:73250722-73250744 CCATACATACTATACAGCTATGG + Intergenic
1055664095 9:78535970-78535992 ACATACATTCTAAAACAGGAAGG - Intergenic
1058616256 9:106831341-106831363 AAATACACACTAAAAGGGGAGGG - Intergenic
1062127757 9:134873178-134873200 ACATACATTTGATAAAGGGGTGG - Intergenic
1189140697 X:38602658-38602680 ACTTACATAATATAAAAGCAGGG + Intronic
1189383754 X:40520307-40520329 ACATACATACATAAAAGCGAGGG + Intergenic
1189464876 X:41270963-41270985 AAATGCATACTATCAAGTGAAGG + Intergenic
1189499432 X:41542090-41542112 ACATACATACTATAAAGGGAAGG + Intronic
1190496825 X:51034379-51034401 ACACACATGCTATAGAGGAAGGG - Intergenic
1193021586 X:76798560-76798582 ACATACACAGTATATAGGCAGGG - Intergenic
1193915550 X:87357880-87357902 ACATTGCTACTTTAAAGGGAAGG + Intergenic
1195572975 X:106417111-106417133 ACTTACATTCTAGGAAGGGAAGG + Intergenic
1199015073 X:142805408-142805430 ACATACAAAAAATAGAGGGAGGG - Intergenic
1199378575 X:147141932-147141954 ACAAACAAGTTATAAAGGGATGG - Intergenic
1199437273 X:147826862-147826884 AGATACAAAGTATAATGGGAAGG - Intergenic
1199776832 X:151019512-151019534 ACCTACATACTCTAAAGAAAGGG + Intergenic
1199924400 X:152447464-152447486 CCATACATTCAATAAAGGAAAGG - Intronic