ID: 1189501111

View in Genome Browser
Species Human (GRCh38)
Location X:41560048-41560070
Sequence CTGTATGAGCAAAAGGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189501111_1189501114 2 Left 1189501111 X:41560048-41560070 CCAATTGCCTTTTGCTCATACAG 0: 1
1: 0
2: 1
3: 10
4: 157
Right 1189501114 X:41560073-41560095 ATGGTCTCACAGATCTTCAATGG 0: 1
1: 0
2: 1
3: 23
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189501111 Original CRISPR CTGTATGAGCAAAAGGCAAT TGG (reversed) Intronic
900961911 1:5927940-5927962 TAGTTTGAGCAAAAAGCAATTGG + Intronic
902318657 1:15643647-15643669 CTAGGTGAGCAAAAGGCACTGGG + Exonic
904152727 1:28455690-28455712 CTGTATTTTGAAAAGGCAATTGG + Intronic
904406659 1:30294982-30295004 CTGTAACAGAAAAAGGAAATAGG + Intergenic
905417125 1:37811749-37811771 CTCTCTGAGTAAAAGGCAAGGGG - Exonic
907647429 1:56258317-56258339 GTGTATGACCAAAATGAAATGGG + Intergenic
909594490 1:77390568-77390590 GTGAATGAAAAAAAGGCAATAGG + Intronic
910787453 1:91015984-91016006 CTGTGTGAGCACTAGGCAAGTGG - Intronic
910898534 1:92094358-92094380 CTGTATGAAAAGAAGGCAAAAGG + Intronic
912798811 1:112707988-112708010 CTCTATGGGCAAAAGGGGATGGG - Intronic
914898733 1:151699640-151699662 CTGTAAAAGCAAAAGGCTGTAGG - Intergenic
915630222 1:157148300-157148322 CTTTAGGAGCAAAGGACAATAGG - Intergenic
916499161 1:165371770-165371792 TTATATCAGCAAAAGGGAATAGG - Intergenic
921029393 1:211324573-211324595 CTTTATGATCAACAGGGAATTGG + Intergenic
921137134 1:212271661-212271683 ATGTATCAACAAAATGCAATTGG - Intergenic
921671286 1:217926684-217926706 CTGTATATGCAATAGGCAAGAGG - Intergenic
923518177 1:234715116-234715138 CTGTATTAGAAAAATGCACTGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924674764 1:246164653-246164675 CAGTATGAGCAAAAAACAAGTGG - Intronic
1066209752 10:33225126-33225148 CTGTAGGAGGAAAATGCTATGGG - Intronic
1067731463 10:48814668-48814690 CTGTAGGCACCAAAGGCAATTGG + Intronic
1068093042 10:52456223-52456245 ATAAATGAGAAAAAGGCAATCGG + Intergenic
1070149867 10:73799107-73799129 CTGTATGAGCAAACTGCAGGTGG + Exonic
1070983077 10:80665888-80665910 CTGTATGAGGAAAAGAAGATGGG - Intergenic
1071866337 10:89736930-89736952 CTATATTAGCAATAGGCAAATGG - Intronic
1074681005 10:115907426-115907448 CACTATGAGCAAAAGGCCATGGG + Intronic
1079797189 11:24819871-24819893 TTTTATGAGCAAAAGACACTAGG + Intronic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1081299927 11:41438493-41438515 CTGAAAGAGTAAAAGGAAATTGG + Intronic
1081388282 11:42499227-42499249 CTGTATGAGCCCAACACAATAGG + Intergenic
1083368910 11:62163004-62163026 CTATAAAAGCAAAAGTCAATTGG + Intergenic
1085865737 11:80289912-80289934 CTGCAGGATCAAAAGGCAAGGGG - Intergenic
1086947680 11:92859487-92859509 CTGAATGTTCAAAAGGAAATGGG - Intronic
1087142566 11:94779545-94779567 CTCTATAAGCAAGAGGTAATGGG + Intronic
1087532716 11:99405514-99405536 CTGTAGGTGAAAAATGCAATTGG - Intronic
1088903852 11:114139250-114139272 CAGTGTGAGCAATTGGCAATGGG - Intronic
1092906516 12:13104667-13104689 CTGTATGAGCAAAGAGGAAATGG - Intronic
1093067153 12:14670037-14670059 GTGTATGAGCATAAAGAAATAGG - Intronic
1095939104 12:47714383-47714405 GTGTATGTTAAAAAGGCAATGGG + Intronic
1098414465 12:70216916-70216938 ATGTAAAAGCAAAAGGAAATGGG + Intergenic
1099727747 12:86455269-86455291 CTGTCTTTCCAAAAGGCAATGGG + Intronic
1100625490 12:96327299-96327321 CTGTTTGAAAAACAGGCAATAGG + Intronic
1103072685 12:117957779-117957801 CTTTATGAACACAAGGCAAAAGG + Intronic
1105264582 13:18804717-18804739 CTGTATGATCAAAAGAAAAGAGG + Intergenic
1107216808 13:37931187-37931209 CTGTATCAGCAAAATGAAAAAGG - Intergenic
1107557570 13:41530554-41530576 TTATATGAACAAATGGCAATTGG + Intergenic
1109048533 13:57445498-57445520 TTGTATGAGCAAAATGCAACAGG + Intergenic
1109065888 13:57689650-57689672 CTGTATATGCATAATGCAATCGG + Intronic
1109939696 13:69345263-69345285 TTCTCTGAGCAAAAGACAATGGG + Intergenic
1110940501 13:81342851-81342873 CTGAAGCAACAAAAGGCAATAGG + Intergenic
1114035936 14:18627269-18627291 CTATATAAGGCAAAGGCAATTGG + Intergenic
1114122703 14:19687753-19687775 CTATATAAGGCAAAGGCAATTGG - Intergenic
1114243089 14:20887270-20887292 CTATATGCTCAAAATGCAATGGG + Intergenic
1114250008 14:20951228-20951250 CTGTGTGCTCAAAATGCAATGGG + Intergenic
1115291761 14:31780031-31780053 CTTTATAAGCAAGATGCAATGGG - Intronic
1115762829 14:36592324-36592346 CTGTAAGAGCTAAAGGAACTTGG - Intergenic
1119184730 14:72632042-72632064 CTTGATGAGCAAAAGGAAAGGGG + Intronic
1125321852 15:38497435-38497457 CAGTAGGAGCAAAAGGCCAAGGG - Intronic
1126401520 15:48276147-48276169 CTGGATGAGCCAATGGAAATGGG + Intronic
1127215438 15:56818558-56818580 CTGTATGACTATAAAGCAATGGG + Intronic
1128759926 15:70209632-70209654 CTGTATGAGCAAGAGGGATTCGG - Intergenic
1131793782 15:95992491-95992513 TTGTTTGAGGAACAGGCAATAGG + Intergenic
1132185720 15:99800411-99800433 CTGAGTGAGAAAAGGGCAATGGG - Intergenic
1132429961 15:101752287-101752309 CTGAGTGAGAAAAGGGCAATGGG + Intergenic
1138282349 16:55781548-55781570 CCGCATGAGCAAAAGGACATAGG - Intergenic
1138286595 16:55815096-55815118 CCGCATGAGCAAAAGGACATAGG + Intronic
1155624557 18:27819612-27819634 ATGAAAGAGCAAAAGGCACTAGG + Intergenic
1156383000 18:36580904-36580926 CTGTATAAGGCAAAGGCAACTGG - Intronic
1157256347 18:46143129-46143151 CTGAAGGAGGAAAAGACAATGGG - Intergenic
1158559154 18:58499217-58499239 CTGGTTCAGCAAAAAGCAATAGG + Intronic
1160393208 18:78552380-78552402 ATATATCAGCAAAAGACAATTGG + Intergenic
1165365319 19:35361760-35361782 CTGTATAAGCAAAAGCCCAGGGG + Intergenic
1165491934 19:36128557-36128579 CTCTATTAGAAATAGGCAATCGG + Intergenic
1166016787 19:39987021-39987043 CTGAATGAGGAAAAGCCAAAAGG + Intronic
925435236 2:3831390-3831412 CAGTCTGGGCAATAGGCAATAGG - Intronic
925545214 2:5008674-5008696 ATGTAGGAACATAAGGCAATTGG + Intergenic
925802558 2:7615469-7615491 CTGTGTGAGTAAAATGCACTAGG + Intergenic
929992529 2:46802149-46802171 CTGTATGGGCAGAAGGCCAAGGG - Intergenic
931533322 2:63242683-63242705 CTGTAAAAGCAAAAGCCATTTGG - Intronic
932701263 2:73993475-73993497 CTCTATGACCAGAAGGGAATGGG + Intronic
933095933 2:78180792-78180814 ATGTATGATCAAATGGAAATTGG - Intergenic
933169828 2:79112936-79112958 CTGAATGACAAAAAGGCAAAAGG + Intergenic
938274457 2:130005688-130005710 CTATATAAGGCAAAGGCAATTGG - Intergenic
938440917 2:131331592-131331614 CTATATAAGGCAAAGGCAATTGG + Intronic
939545245 2:143544003-143544025 ATGTATAAGCAAAAGACAAGAGG - Intronic
940531128 2:154877653-154877675 ATGAATGTGCCAAAGGCAATGGG - Intergenic
943854180 2:192767281-192767303 CCATATGAGCAGAAGGCAAGAGG - Intergenic
944491959 2:200266998-200267020 CTGGATGAGCAAGATGCAACTGG - Intergenic
946353070 2:219168334-219168356 CTTTAGGAGCAAGAGGCAGTGGG + Intronic
948728347 2:239948082-239948104 CTGTTTGAGCAAAAGTCCAGAGG + Intronic
1169003336 20:2184556-2184578 CTGTGAGAGCCAAAGGAAATGGG - Intergenic
1169528018 20:6451519-6451541 ATGTATGAGCAACACGGAATGGG + Intergenic
1169826462 20:9773927-9773949 CAGTATGAGAAAACAGCAATAGG - Intronic
1174294559 20:49536339-49536361 ATATATAAGCAAAAGGAAATGGG + Intronic
1178024881 21:28454959-28454981 CTGTTTCTGCAAAAGCCAATAGG + Intergenic
1179122596 21:38562325-38562347 CAGTATTAACAAAAGGAAATGGG - Intronic
1180460061 22:15554323-15554345 CTATATAAGGCAAAGGCAATTGG + Intergenic
1182689658 22:32149923-32149945 ATGTGTGTGGAAAAGGCAATGGG + Intronic
1183834459 22:40440777-40440799 CTGTAGGAGCAAATGACAATGGG + Intronic
1184212935 22:43047256-43047278 GGGTTTCAGCAAAAGGCAATGGG + Intronic
949700214 3:6747661-6747683 GTGAATGAGCAAAATGGAATAGG - Intergenic
952121688 3:30252575-30252597 ATATCTGAGCAAAAGGAAATGGG + Intergenic
952263907 3:31767204-31767226 CTGCATGAGCAAAACACAAGAGG - Intronic
959809711 3:110602427-110602449 ATGTATTAGCAAAATGCAATGGG + Intergenic
962395899 3:135015134-135015156 CTCCATGAGCAAAAGGCAAGAGG - Intronic
966672956 3:182549587-182549609 CTGTATTAACAAAAGGCTGTAGG - Intergenic
967754320 3:193151675-193151697 ATGGAAGAGCAAAAGGCACTAGG - Intergenic
969522111 4:7684430-7684452 CTGGATGAGGAAAAGGGAAAGGG - Intronic
970302289 4:14693923-14693945 CTGAATAAGCAAAATGCAAATGG + Intergenic
971860568 4:32097824-32097846 ATGTGTAAGCAAAAGGAAATAGG - Intergenic
973536723 4:51890460-51890482 CTGAAACAGAAAAAGGCAATAGG - Intronic
975534258 4:75432974-75432996 CTGAAGGAGCAAAAGTCAAGAGG - Intergenic
981267162 4:142800485-142800507 ATGTATGATCAAATGGAAATTGG + Intronic
984523215 4:180825187-180825209 CAGAAAGAGCAAAAGGCACTAGG + Intergenic
987470040 5:18316806-18316828 TTGTATAATCATAAGGCAATTGG - Intergenic
989582426 5:43045330-43045352 CTGTAAGACCAGAAGGCAATTGG - Intergenic
990556381 5:56940860-56940882 CAATATGAGCCAAAGGGAATGGG - Intronic
991469759 5:66955344-66955366 CTGTAAGTGCAAAGGGCAAGAGG + Intronic
993885276 5:93408733-93408755 CTGTATGAGGTAAAGGCCAATGG + Intergenic
993899009 5:93571957-93571979 CTGACTGAGCAAAGGGAAATCGG + Intergenic
996914742 5:128698880-128698902 CTGTATCATCAAAAGGCTCTGGG - Intronic
998834820 5:146193408-146193430 CTTAATGGGCAAAAGACAATGGG - Intergenic
999103028 5:149043118-149043140 CTGTATTAGAAAAAGGCAGTTGG - Intronic
1001467823 5:171984169-171984191 CTGGATGAGCTACAGGCAAGAGG + Intronic
1005211894 6:23475248-23475270 CTGTAAGAGCTAAAGTCTATTGG - Intergenic
1010029913 6:71262911-71262933 CTGAAGGAGCAAAAGGCCAAAGG + Intergenic
1010516744 6:76782395-76782417 AGGTATGAGCAAAAGGGAAGAGG + Intergenic
1010801053 6:80176099-80176121 CTGGATTAGCAGAAGGAAATGGG + Intronic
1013316060 6:108944284-108944306 CTGCCTGTGCAAAAGGCAAAGGG - Intronic
1013381780 6:109579887-109579909 CTGTATGTTGAAAAGGCAAATGG + Intronic
1013853540 6:114543560-114543582 CTGAATGAGTGAAAGGGAATAGG + Intergenic
1015200030 6:130569001-130569023 CAGTAAGAGCAAAAGGCCAAGGG - Intergenic
1016274381 6:142331473-142331495 CTGTATGACGAAAATGCAGTGGG + Intronic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1018473326 6:164115596-164115618 CTGTATTTGCAAAATGCAAAGGG + Intergenic
1022027911 7:26466040-26466062 GTGTCTGAGCAAAAGGAAAGAGG + Intergenic
1022620828 7:31982991-31983013 CTGAATGAACAAAATGCAACTGG + Intronic
1024019897 7:45359207-45359229 CTGTAAGACTAAAAGGCAGTAGG + Intergenic
1026340615 7:69430978-69431000 CTGCATGAGCCCAAGGCAACTGG + Intergenic
1028904158 7:96134494-96134516 CAGTATGATCAGAAGGCCATGGG + Intronic
1031136448 7:117889559-117889581 CTGTGTGATCAAACGGCATTTGG - Intergenic
1032951555 7:136920573-136920595 CTGTAAGGGCAAAAGGCAGTAGG - Intronic
1035932540 8:3798855-3798877 CTGTATGAACAAAGGAAAATAGG - Intronic
1036168090 8:6456731-6456753 CTGTCTGATCAAAAGGCATGAGG + Intronic
1038374790 8:27028944-27028966 ATTTATGAGGAAAAAGCAATGGG - Intergenic
1041842459 8:62288097-62288119 CTGTAGAAGCACAAGGCAAATGG - Intronic
1043078730 8:75736703-75736725 CTGTTTGAGCAAAAGGCAAATGG + Intergenic
1045887678 8:107118937-107118959 CTGTATGGGAAAATGGAAATGGG - Intergenic
1046020096 8:108654631-108654653 CTGAAAGAGGAAAAGGCAATGGG + Intronic
1046053625 8:109053453-109053475 CTGTATCTGGACAAGGCAATAGG - Intergenic
1047555935 8:125930447-125930469 TTGTAGGGGCAAAAGGCAAGAGG + Intergenic
1050992362 9:12170390-12170412 CAGCATGAGCATAAAGCAATAGG + Intergenic
1051165137 9:14253922-14253944 CAGCATGAGCAAAAGTCAAAGGG - Intronic
1052224328 9:26066605-26066627 TTGTATGAGCAGAATGCAAATGG - Intergenic
1057301421 9:93887258-93887280 CTGCACTAGCAAGAGGCAATGGG + Intergenic
1057438138 9:95061233-95061255 CTGTAGTTGGAAAAGGCAATTGG + Intronic
1057838938 9:98469544-98469566 CTGTATGAGAGAAAGGCAGAGGG - Intronic
1058711801 9:107685447-107685469 CTGAATGGGCAGAAGGCAAATGG - Intergenic
1060284903 9:122241848-122241870 CTGTAGCAGCAAAAGCAAATTGG - Exonic
1060532689 9:124357338-124357360 CTCTATTAGCAACAGGCAGTGGG + Intronic
1186183171 X:6992602-6992624 CAGAATGAGCCAAAGGCAGTGGG + Intergenic
1186366333 X:8898068-8898090 ATGAATGAGCAAATTGCAATTGG - Intergenic
1187043557 X:15622861-15622883 CTGGATGAGAAATAGGGAATAGG - Intergenic
1188078346 X:25806599-25806621 CTGGAGGAGAAAAATGCAATTGG - Intergenic
1189501111 X:41560048-41560070 CTGTATGAGCAAAAGGCAATTGG - Intronic
1189803689 X:44714973-44714995 CTGAATCAGCAAATGTCAATTGG + Intergenic
1190172825 X:48125257-48125279 CTGTATGGCCCAAAGCCAATGGG - Intergenic
1196619224 X:117803608-117803630 CTGGATGAGCATAAGGTACTAGG + Intergenic
1198037751 X:132818649-132818671 GTGGAAGAGCAAAAGGCAAGAGG + Intronic