ID: 1189502347

View in Genome Browser
Species Human (GRCh38)
Location X:41574671-41574693
Sequence TCTTTAGATTTAAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189502343_1189502347 27 Left 1189502343 X:41574621-41574643 CCTAAGAATCACACAGGGAAATT 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1189502347 X:41574671-41574693 TCTTTAGATTTAAGCTCAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189502347 Original CRISPR TCTTTAGATTTAAGCTCAGG AGG Intronic
904337410 1:29807066-29807088 CCATTAGATTAATGCTCAGGAGG + Intergenic
904972064 1:34426978-34427000 TCTTTAGATGTAGACTCAGCTGG - Intergenic
906449634 1:45933924-45933946 ACTTTAGCTTTAGGGTCAGGGGG + Intronic
909810393 1:79925559-79925581 TCTGTAGGTTTGAGCTCTGGAGG + Intergenic
911514618 1:98852003-98852025 TCTTTAGGTCTCAGCTCCGGTGG + Intergenic
913987918 1:143582875-143582897 TCTTTAGATTCCACCTCTGGGGG - Intergenic
916469486 1:165109149-165109171 TCTATAGATTTCACCTCTGGGGG - Intergenic
916707891 1:167371908-167371930 TCATTAGATTTAGACTGAGGTGG - Exonic
920442682 1:205991563-205991585 TCTGTAGATGTTAGCTCAGTTGG + Intronic
921688480 1:218119270-218119292 TCTTTAGATATAAACTCATCAGG - Intergenic
922189229 1:223302533-223302555 TCTCTAGACTCAGGCTCAGGAGG - Intronic
923103678 1:230837751-230837773 ATTTTACATTTAATCTCAGGAGG + Exonic
1063493570 10:6486821-6486843 CCTTTAGGTTGAAGCCCAGGAGG + Intronic
1064084702 10:12336599-12336621 ACTTTTAATTTAGGCTCAGGTGG - Intergenic
1064727321 10:18294030-18294052 TATTTAGACTTGAGTTCAGGAGG + Intronic
1066327181 10:34373568-34373590 TCTCCAGATTTAGGATCAGGTGG + Intronic
1069803585 10:71101570-71101592 TCTTTAGATTAAGGCTTACGTGG + Intergenic
1070092988 10:73307478-73307500 CCTTTAGATGTAAGGACAGGAGG + Intronic
1071027729 10:81136350-81136372 TGTTTTGATTGAAGCTCAGGGGG - Intergenic
1078462763 11:11527482-11527504 TCTGTAGAATAAAGCTCATGTGG - Intronic
1080417839 11:32085856-32085878 TCTTTAGAGTTAGACTGAGGGGG + Intronic
1083060191 11:59861772-59861794 TCTTTACATTTAAGGAAAGGTGG + Intronic
1085360750 11:75883277-75883299 TGGTTAGATATAAGCTCAGCTGG - Intronic
1085728534 11:78976224-78976246 GCTTTAGCTGTAGGCTCAGGAGG - Intronic
1086008701 11:82072061-82072083 GCTTTAGATTTAGTCTCAGCAGG + Intergenic
1086645020 11:89209504-89209526 TCTTTAGATTCCACCTCTGGGGG + Intronic
1086842106 11:91699007-91699029 TCTGTAGATTAAAGTTCAGCTGG - Intergenic
1088698424 11:112390198-112390220 TCTTTAGATTTCAGGTTAGTTGG + Intergenic
1093737827 12:22642948-22642970 TTTTTAGATTTGAGCACAGACGG - Intronic
1094391661 12:29958442-29958464 TCCCTGGGTTTAAGCTCAGGCGG - Intergenic
1104076574 12:125395024-125395046 TCTTAAAATTTAGACTCAGGAGG - Intronic
1111089338 13:83422538-83422560 ACCTGAGATTTAAGCTCAGGCGG + Intergenic
1111134321 13:84020516-84020538 ACTTTAAATTCAACCTCAGGTGG - Intergenic
1111164230 13:84437095-84437117 TCTTCAGATTTAACCAAAGGTGG + Intergenic
1112299928 13:98220605-98220627 CCTTTAAATTTAATCTCATGGGG - Intronic
1114599518 14:23942980-23943002 TCTCTAGATTCCACCTCAGGGGG + Intergenic
1115892492 14:38046951-38046973 CCTTTACATTTCAGCCCAGGTGG + Intergenic
1117399976 14:55350300-55350322 TTTTTAAATTTAAGCTCAGATGG - Intronic
1118467374 14:66043268-66043290 TCTTTGGATTTAACCGCATGGGG + Intergenic
1119240448 14:73055267-73055289 TTTTTCAATTTAAGCTTAGGAGG - Intergenic
1122001837 14:98664849-98664871 TGTTCAGATTCAAGCTCAAGTGG + Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1124912863 15:33939437-33939459 TCTTTAGATTTTACCTCTGTAGG - Intronic
1125282488 15:38057567-38057589 TCTCTAGATAGAATCTCAGGAGG + Intergenic
1132321390 15:100928210-100928232 ACTTTGGATGTAAGCACAGGAGG - Intronic
1137512230 16:49111370-49111392 TTGTTAGTTTTAAGCTCATGAGG - Intergenic
1137857251 16:51807341-51807363 TCTTGAGGTTTAAGATCTGGTGG - Intergenic
1138973639 16:62176189-62176211 TCTTTCTATTTAAGCTTATGTGG + Intergenic
1140473691 16:75228286-75228308 TCTGTAGAGGTAAGATCAGGAGG + Intronic
1142584456 17:962608-962630 ACTTTGGATTTAAGGTGAGGTGG + Intronic
1144240684 17:13308108-13308130 ACTTTTGTTTTAAACTCAGGGGG + Intergenic
1153447869 18:5194653-5194675 TTTTTGGATTTTAGCACAGGAGG - Intronic
1158741511 18:60147557-60147579 TCTTGAGATGTATGCTCAAGGGG + Intergenic
1159076382 18:63686131-63686153 TCTTAAGACTTAGGCTCAGATGG + Intronic
1159803907 18:72931414-72931436 TCTTCAGAGTTAAAGTCAGGAGG - Intergenic
1161672160 19:5619456-5619478 TGTCTAGATTAAAGCTTAGGTGG - Intronic
1164220990 19:23193503-23193525 TCTTAAAATTTATGCTCAGAAGG + Intergenic
1166821576 19:45583811-45583833 CCTTTAGATCTGAGCTCGGGCGG + Intronic
1168435198 19:56311070-56311092 TCTTTTGATATAAGACCAGGGGG + Intronic
1168552816 19:57312135-57312157 ACTTTTATTTTAAGCTCAGGGGG + Intergenic
926281715 2:11454000-11454022 GCTTTAGATTTAAACAAAGGAGG + Intronic
926282213 2:11459159-11459181 TCCTTATATATAAGCTCAGAGGG + Intronic
930326627 2:49928145-49928167 GCTATATATTTAAGATCAGGAGG + Intronic
934963892 2:98702902-98702924 TCTTTACATTTTAACTCAAGTGG - Intronic
937037111 2:118791364-118791386 CCTTCAGCTTTAAGCTGAGGTGG - Intergenic
939572773 2:143860701-143860723 TCTGTAGATTTAAGCACCTGTGG - Intergenic
940479786 2:154213386-154213408 TCTTTATATTGAAGTTAAGGTGG + Intronic
940937123 2:159508703-159508725 TCTTTAAATTTCTGGTCAGGGGG - Intronic
943265015 2:185718656-185718678 TCTTTTGAATAAAGCTGAGGAGG + Intergenic
1174871729 20:54189023-54189045 AAGTTAGATTTAAACTCAGGTGG - Intergenic
1175328521 20:58146792-58146814 TTTTTAGTTTTAAGCTCTGGTGG - Intergenic
1177391484 21:20479347-20479369 TCTTTGAATTTAAGCTCATAGGG + Intergenic
1177405312 21:20659214-20659236 TCTTTAGAATAAATCTCACGCGG - Intergenic
1178465685 21:32845506-32845528 TCTTTACTTTTAACCTCATGAGG + Intergenic
1180165720 21:46026478-46026500 TTTTTAAATTTATGCTCACGAGG - Intergenic
949857573 3:8475898-8475920 TCTTTTGTGATAAGCTCAGGGGG - Intergenic
952701005 3:36327738-36327760 TCTGTAGATTTAAGTTCAGTGGG - Intergenic
954976759 3:54703215-54703237 ACTTTTAATTTAAGTTCAGGGGG - Intronic
956415122 3:69017734-69017756 CCTTTAGATTTAAACACAGGAGG + Intergenic
956964214 3:74439983-74440005 TCTTTATATCAAACCTCAGGGGG - Intronic
957259310 3:77879552-77879574 TCTTTAGACTTTAACTCATGAGG + Intergenic
959675180 3:109026886-109026908 TCTTTGGTTGTAATCTCAGGTGG + Intronic
960345601 3:116527768-116527790 CTTTTAGATTTAAGCTGGGGTGG + Intronic
963290572 3:143483001-143483023 TCTTTAAATTCAAGGCCAGGAGG - Intronic
963474398 3:145786252-145786274 TCATTAGAATTAAGCTCTGTGGG - Intergenic
967277473 3:187790664-187790686 TCTTTAGATGGAAACACAGGAGG - Intergenic
967784120 3:193471490-193471512 TGCTTAAATTTAAGCTCAGGAGG + Intronic
970964385 4:21911435-21911457 TCTTCATTTTAAAGCTCAGGTGG - Intronic
971441734 4:26694448-26694470 TCTGTAGATTTCACCTCTGGGGG + Intronic
975719542 4:77236495-77236517 TCTGGAGTTTTAATCTCAGGTGG + Intronic
977667095 4:99654182-99654204 GCTTTCGAATTCAGCTCAGGAGG + Exonic
978295899 4:107204928-107204950 TTTTTAAATTTATGCTCAGCGGG + Intronic
978395068 4:108270027-108270049 TGTTTGGAGTTGAGCTCAGGTGG + Intergenic
979752054 4:124291023-124291045 TCTTAAGATTGAACCACAGGAGG - Intergenic
982697102 4:158614871-158614893 GCTTTTGATTTAAGGTGAGGAGG + Intronic
983565349 4:169144792-169144814 TGTTAAGATGTAAACTCAGGAGG - Intronic
987966982 5:24890242-24890264 TCTTTTGTTTTAAGCTCAGGAGG - Intergenic
988984322 5:36602035-36602057 TCTGGAGATTTAAACCCAGGGGG + Intergenic
993215152 5:85012637-85012659 TCTTCAGATTTAAGCTAATCAGG + Intergenic
996870673 5:128189498-128189520 TTTAAAGATTTAAGCTCTGGTGG + Exonic
998665452 5:144292163-144292185 ACTTTTGTTTTAAGCCCAGGAGG + Intronic
1001796017 5:174503162-174503184 TCTTTGGATCTCAGCTCAGATGG - Intergenic
1008141873 6:47841177-47841199 TCTTTAGATTTGGACTTAGGAGG - Intergenic
1008214794 6:48775593-48775615 CCTCTACCTTTAAGCTCAGGAGG + Intergenic
1010295984 6:74196178-74196200 TGTTTAGCTTTAAACTGAGGTGG + Intergenic
1013205718 6:107944157-107944179 TTTTTACCTTTAAGCTCTGGTGG - Intronic
1014675105 6:124354276-124354298 TCATTTGATTTGAGTTCAGGAGG + Intronic
1015512924 6:134057593-134057615 TCATTATATTTCAGCTCAGGTGG + Intergenic
1016523851 6:144977321-144977343 TCTATAGATTTTACCTCTGGGGG - Intergenic
1023576981 7:41638711-41638733 TCTTTATATAAAAGCACAGGAGG + Intergenic
1024567445 7:50693645-50693667 TGTTTTGATTCCAGCTCAGGAGG + Intronic
1025172728 7:56775296-56775318 TCTGTAGATTCAAGTTCAGATGG - Intergenic
1025699389 7:63802872-63802894 TCTGTAGATTCAAGTTCAGATGG + Intergenic
1027584269 7:80038118-80038140 TATTTTACTTTAAGCTCAGGAGG - Intergenic
1028597803 7:92565449-92565471 TATATATATATAAGCTCAGGTGG - Intronic
1033763927 7:144466464-144466486 TCATTTGATTTAAGTTCAGATGG + Intronic
1037009643 8:13824548-13824570 TTTTTCTATTTAAGCCCAGGGGG - Intergenic
1037011030 8:13842538-13842560 TTTGTATATTTAAGTTCAGGAGG - Intergenic
1038268781 8:26058547-26058569 TCTCTAGATTTAAGCTCCAATGG + Intergenic
1039038570 8:33385287-33385309 TCTGTAGATTCAAGTTCAGTGGG - Intronic
1041279344 8:56195700-56195722 TCCTTAGATTTGGGCTGAGGTGG - Intronic
1042451154 8:68948481-68948503 TCTTAAGATTTTACCTTAGGTGG + Intergenic
1046096141 8:109563589-109563611 TTTTTAAACTTAAGTTCAGGGGG + Intronic
1050803682 9:9647049-9647071 TATTTAGAATTAAGCACAGATGG - Intronic
1051901822 9:22051182-22051204 TCTTTCATTTTCAGCTCAGGGGG - Intergenic
1052246605 9:26343503-26343525 TCTTTAGATTAAAGCTTTTGGGG - Intergenic
1052999539 9:34570038-34570060 TCTTCAGACTGAAGGTCAGGGGG - Intronic
1053147218 9:35719838-35719860 TCTTTAGACTTCAGCCCAGCAGG - Exonic
1053565475 9:39245932-39245954 TCTTTAGATTTTAGGCTAGGTGG - Intronic
1053831243 9:42083788-42083810 TCTTTAGATTTTAGGCCAGGTGG - Intronic
1054131673 9:61373107-61373129 TCTTTAGATTTTAGGCTAGGTGG + Intergenic
1054599304 9:67103650-67103672 TCTTTAGATTTTAGGCCAGGTGG + Intergenic
1055589402 9:77795554-77795576 TGTTTAGGTTTAATGTCAGGAGG - Intronic
1058799589 9:108532101-108532123 TGTTTAGATTGAAGCTGAGCAGG + Intergenic
1059654883 9:116348502-116348524 ACTTTTATTTTAAGCTCAGGAGG + Intronic
1186113498 X:6280020-6280042 TCTTTATTTTTAAGCTTAGGAGG - Intergenic
1187581628 X:20613270-20613292 TCTTCAGATTTAGGCTCAAGTGG - Intergenic
1188797668 X:34484993-34485015 TATTTAAATTCAAGCTCAAGGGG - Intergenic
1189502347 X:41574671-41574693 TCTTTAGATTTAAGCTCAGGAGG + Intronic
1189585765 X:42460231-42460253 TCTTTAGACTTAAGTTCAACTGG + Intergenic
1190683389 X:52849161-52849183 TCTGTAGACTTAACCTCTGGGGG - Intergenic
1192997447 X:76527445-76527467 TCTCTAGATTTCACCTCTGGGGG - Intergenic
1193352860 X:80482440-80482462 TCTTTAGATTATAGTTAAGGTGG - Intergenic
1196618726 X:117797444-117797466 CCCTTAGATTCAATCTCAGGGGG - Intergenic
1197004893 X:121483446-121483468 TCTTCAAATTTAAGCTTATGGGG - Intergenic
1197822446 X:130554924-130554946 TCAGGAGATTCAAGCTCAGGAGG + Intergenic
1201636945 Y:16133661-16133683 TCTTTAGATAAAAGCTGAGAAGG - Intergenic