ID: 1189504789

View in Genome Browser
Species Human (GRCh38)
Location X:41601587-41601609
Sequence AATGGCCCTGTGAAATCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189504787_1189504789 4 Left 1189504787 X:41601560-41601582 CCACAAAGCTAAATTTTAATTTA 0: 1
1: 0
2: 5
3: 79
4: 768
Right 1189504789 X:41601587-41601609 AATGGCCCTGTGAAATCTAGTGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189504789 Original CRISPR AATGGCCCTGTGAAATCTAG TGG Intronic
902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG + Intergenic
904499210 1:30904455-30904477 AATGGCCTTTTGAAACCCAGTGG - Intronic
907956787 1:59236173-59236195 CAAGGCACTGAGAAATCTAGTGG - Intergenic
908494813 1:64683864-64683886 AATGTCCCTGTGATGCCTAGAGG + Intronic
908537040 1:65087959-65087981 AAAGGCCCTGAAACATCTAGAGG + Intergenic
910729973 1:90384443-90384465 AATGGCCCTGTTATATGGAGAGG - Intergenic
911907453 1:103588317-103588339 ATATGTCCTGTGAAATCTAGGGG + Intergenic
918332816 1:183475510-183475532 AATGACTCTGTGTAATGTAGTGG + Intronic
919401185 1:197119269-197119291 AATGCCCTTGTGAAACCTATGGG + Intronic
920186501 1:204162618-204162640 AGTGCCCCTGTCAAAACTAGGGG + Intronic
920626454 1:207606351-207606373 AATGGCCCAGTTAAAAATAGAGG + Intronic
921432430 1:215081077-215081099 AAGGTCCCTCTGAAATCTACAGG - Intronic
922195171 1:223353445-223353467 TATGTCCCTGTGAAGTCCAGAGG + Intronic
922983565 1:229849255-229849277 AGTGGCCCTGTGTCCTCTAGGGG - Intergenic
923009507 1:230076999-230077021 AATTGCCCTGTGAGAGCTTGAGG + Intronic
923082635 1:230673146-230673168 ACTGGCCCTGTCAAATCTAATGG - Intronic
924007698 1:239630471-239630493 AATATCCCTGTAAAATCTAATGG - Intronic
1063259490 10:4369638-4369660 AACGGCCCTGTAATATCTTGGGG - Intergenic
1063844520 10:10111249-10111271 AATTCCCCTGTAAAATTTAGAGG + Intergenic
1065280313 10:24130849-24130871 AATTGGCCTTTGAAATCTAGAGG - Intronic
1067161560 10:43829570-43829592 AATCCCACTCTGAAATCTAGAGG + Intergenic
1069347989 10:67492698-67492720 AATTGTCCTGTGAGCTCTAGGGG + Intronic
1073910969 10:108343933-108343955 AAAGGGCCTCTGAAATGTAGAGG + Intergenic
1073953409 10:108838251-108838273 AATGGCAATGTGAAATCAAAAGG - Intergenic
1078681226 11:13478520-13478542 TATGGCCCTGGGGAAGCTAGTGG + Intergenic
1080636836 11:34131551-34131573 ACTGGCCCTGTGAAAAGGAGAGG + Intronic
1080770663 11:35338358-35338380 AATTGCCCTGAGAAGTCGAGAGG - Intronic
1081223180 11:40488363-40488385 AATGGCCCAGAGAAATTCAGTGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1090345371 11:126064705-126064727 AATGGCACTGTGAGATCTGGAGG - Intergenic
1092630906 12:10375874-10375896 AATTGCTCTGTGCAATCAAGTGG + Intronic
1096594416 12:52685529-52685551 ACTTGCCCTGGGAAAGCTAGGGG + Intergenic
1096610537 12:52798263-52798285 TATGTTCCTGTGAGATCTAGAGG - Intergenic
1097140982 12:56902440-56902462 GATAGCCCAGTGAAATCAAGAGG - Intergenic
1097366816 12:58724722-58724744 AATGGATCTGAGAAATATAGGGG + Intronic
1097621800 12:61947615-61947637 AATGGCCCAGTGAATTAGAGTGG - Intronic
1099541990 12:83922824-83922846 AATGGCCTTCTGAAATAGAGTGG - Intergenic
1102876025 12:116449409-116449431 TCAGGCCCTGTGGAATCTAGGGG - Intergenic
1116107341 14:40526962-40526984 AATGGCTCTATGGTATCTAGTGG + Intergenic
1117836258 14:59809555-59809577 AATGGCTCAGTGAAATATAAAGG + Intronic
1120556071 14:85931018-85931040 AATGGACCAGTGATATCTTGTGG + Intergenic
1121816808 14:96934950-96934972 AATTGCCTTGTGAAAGCCAGTGG - Intergenic
1124722057 15:32118892-32118914 ACAGGCCCTGTGATATCAAGTGG + Intronic
1125834879 15:42740238-42740260 CATGGCCCTGTGCAATGTAACGG - Exonic
1128428130 15:67564241-67564263 AATGGCCCTGTGCAGTATAAAGG - Intronic
1129937479 15:79463002-79463024 AATTGCACTGTGAAATCCAAGGG + Intronic
1132313377 15:100873247-100873269 CTTGGTCCTGTGACATCTAGTGG + Intergenic
1133900732 16:9971856-9971878 AATGTCCCTGTGAAATCTACTGG - Intronic
1136551083 16:30982974-30982996 AATGCCCCAGGGACATCTAGGGG + Intronic
1137638562 16:50008802-50008824 ATACGTCCTGTGAAATCTAGGGG - Intergenic
1140627344 16:76810250-76810272 AATAACTCTGAGAAATCTAGAGG + Intergenic
1141016254 16:80452901-80452923 AATAGCTGTGTGATATCTAGAGG - Intergenic
1143141441 17:4743857-4743879 AGGGGCCCTGTGGAAGCTAGGGG + Intronic
1150461949 17:65360909-65360931 AATGGGCCTGTGGCAGCTAGGGG + Intergenic
1154166614 18:12019590-12019612 AGTTGCAGTGTGAAATCTAGTGG + Intronic
1155163465 18:23214337-23214359 CATGGCCCTGTGGAATATGGTGG - Intronic
1156323845 18:36054635-36054657 ATTGGCCATGGGAAATCTGGAGG + Intronic
1157955883 18:52097112-52097134 CATTGCTCTGTTAAATCTAGAGG - Intergenic
1161870025 19:6862839-6862861 AATGTCCCTGTTTGATCTAGTGG - Intergenic
1162983016 19:14250900-14250922 GTTGGCCATGTGAGATCTAGGGG - Intergenic
1166913269 19:46176543-46176565 AATGGCCCTGTGCAATCTTTAGG - Intergenic
925576665 2:5367350-5367372 AAGGGCCCTGTGAAATTTGAAGG + Intergenic
925998191 2:9308856-9308878 AAGGGCCCTGTGTCATCTGGTGG + Intronic
926072823 2:9914132-9914154 AAAAGCCCTCTGAAATTTAGAGG - Intronic
926653161 2:15368722-15368744 CTTGGCCCTGTGACATCTACAGG + Intronic
927147287 2:20174550-20174572 CATGGCCCTGTGCAAGCTGGAGG - Intergenic
929441798 2:41970874-41970896 AAAGGCCCTGTGATATGGAGAGG - Intergenic
935806252 2:106750738-106750760 AATGAGCCTGTGATATCAAGAGG + Intergenic
935881268 2:107568553-107568575 AATGTCACTGTGGAATTTAGGGG - Intergenic
936715236 2:115179305-115179327 AATGACACTGTGAAGTCTAAAGG + Intronic
938272613 2:129988111-129988133 AATAACCCTCTGAAATGTAGTGG - Intergenic
938666378 2:133542555-133542577 ACTGGCACTGTGAAATATGGCGG - Intronic
939770579 2:146311010-146311032 AGTGGCCTTGTGAAATTTACAGG - Intergenic
941124778 2:161571635-161571657 AATGTCTCTGTGAAATCTTTAGG + Intronic
945037758 2:205718570-205718592 AGTGGCCCTGAGAAGTCTATGGG - Intronic
947181290 2:227413634-227413656 TGTGGCCATGTGAAATCCAGTGG + Intergenic
1170177573 20:13489330-13489352 AAGGGGCCTGTGAAATATAGGGG + Intronic
1178353398 21:31889890-31889912 TATGTCCCTTTGAAATCTGGAGG - Intronic
1179766010 21:43573702-43573724 GAAGGCCCTGTGAAATGAAGGGG + Intronic
958450532 3:94267248-94267270 AAAGGCACTGTCAAATGTAGTGG + Intergenic
959239983 3:103778509-103778531 TATAGCCCTGTGAAATAGAGTGG + Intergenic
959369918 3:105510485-105510507 AAAGTCTCTGTGAAGTCTAGTGG - Intronic
961663215 3:128481329-128481351 ACTGGCCCTCTGAAAACTGGTGG - Intronic
963820430 3:149885953-149885975 AATGGCGCTGAGAAAACTGGAGG - Intronic
964576082 3:158170080-158170102 AATTACCCTGTGAAATTTATTGG + Intronic
965162129 3:165147556-165147578 TATGGCCCTGTGATATGAAGGGG - Intergenic
970238545 4:13983638-13983660 AATGGCCCTCTGAGAGCCAGAGG - Intergenic
972092992 4:35311891-35311913 AATGCTCCTGGGAAATCAAGTGG - Intergenic
972290776 4:37687723-37687745 AATAGTCCTCTGAAAACTAGAGG - Intergenic
972934384 4:44114471-44114493 AATGGCCATCTAAAATCTAAGGG - Intergenic
974448318 4:62015668-62015690 AATGTCCCTGTGAAAATTAAGGG - Intronic
976149980 4:82081890-82081912 AATGGTCCTGTAAAACCCAGGGG - Intergenic
984520241 4:180793520-180793542 AATGAATCTGTGAAATCTTGAGG + Intergenic
984664836 4:182415121-182415143 AAAGGCCATCTGAAATCTATAGG - Intronic
986751787 5:10794269-10794291 GTTAGCCATGTGAAATCTAGTGG + Intergenic
987580809 5:19789124-19789146 AATTGCCCTGTGACAATTAGTGG - Intronic
990045538 5:51426070-51426092 AATGGGGCTGTGTCATCTAGAGG + Intergenic
993313869 5:86374608-86374630 CTTGACACTGTGAAATCTAGGGG + Intergenic
993727321 5:91383013-91383035 AATGTCCCTGTGTATTCTAGTGG - Exonic
996765045 5:127027721-127027743 ACTGGCCTTGTGAAATTTATAGG - Intronic
996932434 5:128906104-128906126 AAAAGCAATGTGAAATCTAGGGG - Intronic
998049721 5:139022270-139022292 AGGGGCCCTGTGGAATCTGGAGG - Intronic
1000217373 5:159174104-159174126 AATGTCCCTGTGGAATCAACTGG - Exonic
1002015041 5:176314426-176314448 AACAACCTTGTGAAATCTAGGGG + Intronic
1002158181 5:177299363-177299385 AGTGGCCCAGTGCAATCCAGAGG + Exonic
1004479344 6:16003970-16003992 AACAGCCCTGTGAAATCGTGTGG - Intergenic
1004735545 6:18402564-18402586 AGAGGCTCTGTGAAATCTTGTGG + Intronic
1005138802 6:22602536-22602558 AATGGCCTTGTGACACATAGAGG + Intergenic
1005358957 6:25012421-25012443 AATGGCACTGTGAACACTTGTGG - Intronic
1005668625 6:28082089-28082111 AATGGCCCAGTAAAATATAAGGG + Intronic
1007786100 6:44280185-44280207 AATGGCCCTGAGAACTCTGTGGG - Exonic
1011980290 6:93366702-93366724 AATGGCACGGTGAAAGCGAGAGG - Intronic
1017296901 6:152808118-152808140 ACTGACCCTGACAAATCTAGGGG + Intergenic
1017307376 6:152934803-152934825 AATAGCCTTTTGAAATCTAGGGG - Intergenic
1018927744 6:168218174-168218196 AAAGCCACTGTGAAATCAAGAGG - Intergenic
1031017238 7:116588162-116588184 GATGGCCTTGTGAAAACTAGAGG + Intergenic
1031869506 7:127076684-127076706 AATGGCCCTGTAACAGCTTGGGG - Intronic
1031895172 7:127340046-127340068 AATGGCACTGGGAAGTCTTGGGG - Intergenic
1035743436 8:1945465-1945487 GCTGACCCTGTGAAATCGAGAGG - Exonic
1050344873 9:4676408-4676430 AAAGTTCCTGTGAAACCTAGTGG - Intergenic
1056744012 9:89284226-89284248 AATGTCCATGTGAAAGCAAGAGG - Intergenic
1057110950 9:92470441-92470463 AATAGCCATGTAAAATGTAGTGG - Intronic
1188009208 X:25039665-25039687 AATGACCCAGGGAACTCTAGTGG + Intergenic
1189504789 X:41601587-41601609 AATGGCCCTGTGAAATCTAGTGG + Intronic
1189908962 X:45790363-45790385 CATGGCACTGTTGAATCTAGAGG - Intergenic
1194996296 X:100595000-100595022 AATGGCCCTTTAAAACCTAATGG + Intronic
1195129295 X:101838516-101838538 AATGGCCCTGGAAATTCCAGTGG + Intronic
1195176941 X:102321314-102321336 AATGGCCCTGGAAATTCCAGTGG - Intronic
1195181923 X:102365779-102365801 AATGGCCCTGGAAATTCCAGTGG + Intronic