ID: 1189506865

View in Genome Browser
Species Human (GRCh38)
Location X:41619900-41619922
Sequence ATGAAAAATACGTGAACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 418}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189506865_1189506866 -5 Left 1189506865 X:41619900-41619922 CCATCAGTTCACGTATTTTTCAT 0: 1
1: 0
2: 2
3: 26
4: 418
Right 1189506866 X:41619918-41619940 TTCATTCATTTCAAATTAAATGG 0: 1
1: 0
2: 12
3: 77
4: 674
1189506865_1189506867 1 Left 1189506865 X:41619900-41619922 CCATCAGTTCACGTATTTTTCAT 0: 1
1: 0
2: 2
3: 26
4: 418
Right 1189506867 X:41619924-41619946 CATTTCAAATTAAATGGCAGTGG 0: 1
1: 1
2: 1
3: 32
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189506865 Original CRISPR ATGAAAAATACGTGAACTGA TGG (reversed) Intronic
906783890 1:48597204-48597226 ATGATAAATACCTTAACAGAAGG - Intronic
906896950 1:49785346-49785368 ATGACAAATATGTGAGGTGATGG + Intronic
907655958 1:56342158-56342180 ATGATAAATGCATGAAGTGATGG + Intergenic
907750006 1:57253784-57253806 ATGAAAAATAATTGCATTGAAGG + Intronic
908162599 1:61425585-61425607 ATGATAAAGAAGTGAATTGAAGG + Intronic
909164984 1:72210321-72210343 ATTAAAAATATGTGTACTCAAGG - Intronic
909487651 1:76191549-76191571 ATGATAAATACATGAGGTGATGG + Intronic
909627459 1:77733483-77733505 ATGAAACATAAGAAAACTGAAGG + Intronic
911313642 1:96328912-96328934 ATGATAACTATGTGAAGTGATGG + Intergenic
911399316 1:97354911-97354933 ATGAAAAATAAAGAAACTGATGG - Intronic
911850252 1:102809095-102809117 ATAAAAAATACTTAAACAGAAGG + Intergenic
911993387 1:104731857-104731879 ATGAAAATTCCGAGACCTGATGG - Intergenic
912205872 1:107509084-107509106 ATGATAAATACTTGAGGTGATGG + Intergenic
913385354 1:118252990-118253012 ATCAATAATAGGTGAATTGAAGG - Intergenic
916605346 1:166337042-166337064 ATGATAAATACTTGAGGTGATGG + Intergenic
916909681 1:169333252-169333274 ATGAAAAAAAATTGAACTCATGG + Intronic
917673057 1:177292286-177292308 AAGATAGATACATGAACTGATGG - Intergenic
918175323 1:182039154-182039176 ATTAAAATCATGTGAACTGAAGG + Intergenic
919234288 1:194818434-194818456 ATGATAAATACTTAAAGTGATGG + Intergenic
919605248 1:199674236-199674258 ATTAAAAATACATTAACTGCCGG + Intergenic
920892243 1:209999926-209999948 ATGATAAATACCTGAGGTGATGG + Intronic
921950990 1:220929784-220929806 ATGAAGAATTCTTGAAGTGAAGG + Intergenic
923105123 1:230848569-230848591 ATTAAAAATACTCGAAGTGATGG + Intronic
924460197 1:244252334-244252356 ATAAAAGATATGGGAACTGATGG + Intergenic
1063705117 10:8422924-8422946 ATGAAAAATATGTCAACTGTGGG + Intergenic
1064704859 10:18061172-18061194 ATGATAAATGCTTGAGCTGATGG + Intergenic
1064951289 10:20853912-20853934 ACGACAAATGCTTGAACTGATGG + Intronic
1065269980 10:24019215-24019237 ATGATAAGTAGGTGAGCTGATGG + Intronic
1065501800 10:26390720-26390742 ATGATAAATACTTGAGGTGATGG + Intergenic
1065629725 10:27666138-27666160 ATGATAAATGCATGAAGTGATGG + Intergenic
1065758531 10:28959022-28959044 ATGATAAATATATGAAGTGATGG + Intergenic
1066554571 10:36597204-36597226 ATGAAAAATGCTTGAGGTGATGG - Intergenic
1068457244 10:57272032-57272054 ATGATAAATACTTGAGGTGATGG - Intergenic
1068916196 10:62434319-62434341 ATGAAAAACAAATCAACTGATGG + Intronic
1070759811 10:79017033-79017055 ATGAAAAATACCTACTCTGAGGG - Intergenic
1071183338 10:83012525-83012547 AAGAAAAATAGGAGAACTGTGGG - Intergenic
1071195778 10:83157507-83157529 TAGAAAAATATGTGAAGTGAAGG - Intergenic
1071303096 10:84272525-84272547 CTGAAAAACAGGTGAACAGATGG - Intergenic
1072223906 10:93350402-93350424 ATGAAAATCACTTGAACTCAGGG - Intronic
1072345313 10:94499132-94499154 CTGAGAAATACGTGAGCTGATGG - Intronic
1073408762 10:103322193-103322215 AATAAAAATAAGTGAAGTGAAGG - Intronic
1074202695 10:111253213-111253235 ATGATAAATGCTTGAAGTGATGG + Intergenic
1074643992 10:115423114-115423136 ATGATAAATCCGTGAGGTGATGG + Intronic
1075215932 10:120534748-120534770 TTGAAAAGTACATTAACTGAAGG - Intronic
1075422061 10:122309000-122309022 AGGACATATACATGAACTGAGGG - Intronic
1075816381 10:125267577-125267599 ATGATAAATACTTGAGGTGATGG - Intergenic
1080046501 11:27814119-27814141 ATGAAAACCAGGTGATCTGAAGG + Intergenic
1080286422 11:30619574-30619596 ATGAAAGATAGGTGAACTGAAGG - Intergenic
1080729846 11:34938130-34938152 ATGAAGAATTTGTGAACAGAAGG + Intronic
1080740234 11:35057219-35057241 ATGAACTGTAGGTGAACTGAGGG - Intergenic
1080951757 11:37041952-37041974 ATGAAAACTACGTGACCCAAAGG - Intergenic
1082234509 11:49807283-49807305 ATGATAAATATGTGAGGTGATGG - Intergenic
1083369495 11:62166992-62167014 ATGAAGAAAATGTGAAGTGATGG - Intergenic
1086341057 11:85848966-85848988 AAGAAAAAAAAGTGAACTGCAGG + Intergenic
1086617070 11:88834138-88834160 ATGATAAATACGTGAGGTGATGG + Intronic
1086965405 11:93021977-93021999 ATGAAATAAATGTAAACTGAAGG + Intergenic
1087358625 11:97128439-97128461 ATGATAAATATATGAGCTGATGG - Intergenic
1087509933 11:99078969-99078991 ATGACAAATACTTGAGGTGATGG + Intronic
1087559693 11:99771989-99772011 ATAAAAAATATGGGCACTGAGGG + Intronic
1088317479 11:108521934-108521956 ATGAAAAGTACATGAACAGAGGG + Intronic
1088347617 11:108846232-108846254 ATGATAAATATTTGAAGTGATGG - Intronic
1090150057 11:124374509-124374531 ATGTAAAATAGGTGAAGTGTGGG + Intergenic
1090296855 11:125595821-125595843 ATGAAAATTAAGTAAATTGAAGG + Intronic
1091040501 11:132275801-132275823 ATGAAAAATACATGAGGCGATGG - Intronic
1092010353 12:5105263-5105285 ATGTGATATAAGTGAACTGAAGG + Intergenic
1092667472 12:10819174-10819196 ATGATAAATGCTTGAAGTGATGG + Intergenic
1093656907 12:21705416-21705438 ATGATAAATACTTGAGGTGATGG - Intronic
1093705738 12:22273259-22273281 ATGAAAAATAGGTGAACGGTGGG - Intronic
1094266161 12:28562658-28562680 ATGATAAGTATGTGAAATGATGG + Intronic
1094561551 12:31558637-31558659 ATGAAAAATACTCATACTGATGG + Intronic
1094690951 12:32768352-32768374 ATGACAAACACATGAACTAAGGG + Intergenic
1095316921 12:40774965-40774987 ATGATAAATACTTGAGATGATGG - Intronic
1095627669 12:44336319-44336341 ATAAAAAAGAAGTGAATTGATGG + Intronic
1095693097 12:45113128-45113150 ATGAAAATGAAGAGAACTGAAGG + Intergenic
1098491182 12:71081133-71081155 ATTTGAAATACGTGAAGTGATGG - Intronic
1099237606 12:80100349-80100371 ATGATAAATGCTTGAAGTGATGG + Intergenic
1099311208 12:81026351-81026373 ATGATAAATATGTGAGGTGATGG + Intronic
1099328352 12:81248731-81248753 ATGATAAATACTCGAAGTGATGG + Intronic
1099418987 12:82429008-82429030 ATGATAAATGCTTGAAGTGATGG - Intronic
1099652875 12:85451342-85451364 ATGATAAATGCATGAAATGAGGG - Intergenic
1099689085 12:85927530-85927552 ATGTAAAATAAGTGGGCTGATGG - Intergenic
1100490940 12:95077305-95077327 ATGCAAAAGATATGAACTGAAGG + Exonic
1100666107 12:96755317-96755339 ATGATAAGTATGTGAAGTGATGG - Intronic
1101010607 12:100445396-100445418 AGATAAAATACGTGAAATGATGG - Intergenic
1101491612 12:105214894-105214916 AATAAAAATACCTGAACTGCAGG + Intronic
1102129148 12:110511750-110511772 ATGATAAATACTTGAGGTGATGG + Intronic
1103294225 12:119872556-119872578 ATTAAAAAGAGATGAACTGAGGG + Intronic
1105349883 13:19605554-19605576 ATGAAAAATAAATGCACTGAAGG + Intergenic
1105642534 13:22280453-22280475 TTTAAAAATAAGTGTACTGAAGG + Intergenic
1106300896 13:28464356-28464378 ATGATAAATACATGACCTAACGG + Intronic
1107176627 13:37406915-37406937 CTGAAATATACCTGAACTGGGGG - Intergenic
1107307269 13:39036723-39036745 ATGCAAAATTCGTGTCCTGATGG - Intronic
1107680955 13:42849762-42849784 ATTAAAAAGACTTGTACTGAAGG + Intergenic
1107765818 13:43733371-43733393 GTGGAAAATAACTGAACTGATGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108893005 13:55285368-55285390 ATGATAAATGCTTGAAGTGATGG + Intergenic
1109151373 13:58852539-58852561 CTGGAAAATACATGAACTAAAGG + Intergenic
1109805887 13:67442274-67442296 ATGATAAATGCTTGAAGTGATGG - Intergenic
1109858652 13:68168935-68168957 ATGAAAAATTTGTTAATTGAGGG + Intergenic
1110625605 13:77652310-77652332 ATCAGAAATACCTTAACTGAGGG + Intergenic
1110669495 13:78160346-78160368 ATTAAAAATAGGTTAAGTGAGGG - Intergenic
1110974069 13:81807608-81807630 ATGACAAGTATGTGAAGTGATGG + Intergenic
1111423810 13:88052702-88052724 ATGTAAAATAGGTGAAGTGTGGG + Intergenic
1112176677 13:97032561-97032583 AGGATAAATACTTGAAGTGATGG + Intergenic
1114746434 14:25153244-25153266 ATGATAAATATTTGAAATGATGG - Intergenic
1114820748 14:26016449-26016471 ATGATAAATGCTTGAAGTGATGG + Intergenic
1115414620 14:33117169-33117191 ATGATAAATGCATGAAGTGATGG - Intronic
1115608895 14:35033423-35033445 ATGAAAACTGTGAGAACTGAAGG - Intergenic
1115746278 14:36441013-36441035 ATGAAAAATATTTGCAATGATGG - Intergenic
1116348800 14:43832448-43832470 ATGAAAAATGCTTGATGTGATGG - Intergenic
1117713956 14:58561797-58561819 AAGAAAAAAAAGTGAAATGAAGG - Intergenic
1118645774 14:67837760-67837782 ATGATAAATGCTTGAAGTGATGG - Intronic
1119829743 14:77691200-77691222 AAAAAAAATACTTGAACTTAAGG - Intronic
1120460792 14:84792634-84792656 ATGTAAAATAGGTGAACGGTGGG - Intergenic
1120602453 14:86528449-86528471 ATTAAGAATGCGTGAACTAAGGG - Intergenic
1122026633 14:98882324-98882346 ATGGACAATACGTAAACTAATGG + Intergenic
1122928085 14:104918747-104918769 ATGACAAAGACTTGAAGTGATGG - Intergenic
1123885333 15:24721276-24721298 ATGATAAATACTTGAGTTGATGG - Intergenic
1125414830 15:39441678-39441700 ATGAAAAAGACATGTAATGAGGG + Intergenic
1126846869 15:52768216-52768238 ATGATAAATGCTTGAAGTGATGG + Intronic
1128404615 15:67322973-67322995 ATGTAAAATAGGTGAACAGTGGG + Intronic
1128573242 15:68751276-68751298 ATGACAAATATTTGAAGTGATGG - Intergenic
1129952707 15:79606214-79606236 ATGTAAAATACCTGAAATAATGG + Intergenic
1130787045 15:87110572-87110594 ATGGTAAATACTTGAAGTGATGG + Intergenic
1132265739 15:100469148-100469170 ATGGAAAATGTGTGACCTGACGG - Intronic
1132270414 15:100519432-100519454 CTGAAAAAAAAGTGAACGGAAGG + Intronic
1132296162 15:100736210-100736232 ACGACAAATATGTGAAGTGATGG - Intergenic
1133005592 16:2879848-2879870 ATGTAAAATAGGTGAAATGTGGG - Intergenic
1135475462 16:22770725-22770747 ATGCAAAAAACCTGAAATGATGG + Intergenic
1135490020 16:22900997-22901019 ATGAAAAAGGCTTGAACTAAAGG + Intronic
1135802990 16:25516476-25516498 ATGATAAATACTTGAGGTGATGG - Intergenic
1137092086 16:36205933-36205955 AGGAAAAATACATAGACTGATGG + Intergenic
1138204350 16:55114006-55114028 CTGAACAAGACGTGAACTGTAGG - Intergenic
1138730458 16:59188475-59188497 ATGTGAAATACGTGAAATGATGG - Intergenic
1139124317 16:64059157-64059179 ATGAGCAAAATGTGAACTGAGGG - Intergenic
1139129341 16:64122002-64122024 ATGATAAATACTTGAGATGATGG + Intergenic
1139856012 16:69980832-69980854 ATGGAAAACAAGTGGACTGAGGG + Intergenic
1141009284 16:80382289-80382311 ATGAAAAATATGCAAAGTGAAGG + Intergenic
1143102784 17:4513516-4513538 ATGAATAATACCTGCCCTGAGGG + Intronic
1144151123 17:12447881-12447903 ATGAAAAATACAGGACCAGATGG - Intergenic
1144492865 17:15729881-15729903 ATGAAAAATAAGCCACCTGAAGG + Intergenic
1144907388 17:18646778-18646800 ATGAAAAATAAGTCACCTGAAGG - Intronic
1147502607 17:40979920-40979942 ATGATAAATACTTGAGGTGATGG + Intronic
1149096316 17:52845097-52845119 ATGACAAATACTTGAGATGATGG - Intergenic
1149536025 17:57434054-57434076 ATGATAAGTATGTGAAGTGATGG - Intronic
1151067649 17:71169932-71169954 ATGATAAATACTTGAGGTGATGG - Intergenic
1152648385 17:81480876-81480898 ATGGAAAATACGTGAATTAAAGG - Intergenic
1154460489 18:14579826-14579848 ATGATAAATATTTGAAATGATGG - Intergenic
1154466819 18:14652997-14653019 AAGAAAAAAACGTGAAATAATGG + Intergenic
1155573137 18:27217119-27217141 ATGAAAAATATTTGAGATGATGG + Intergenic
1156783623 18:40882234-40882256 ATGTAAAATAGGTGAACGGTGGG - Intergenic
1157666639 18:49492921-49492943 GTGAAAAATGCGCTAACTGAAGG + Intergenic
1158578656 18:58662064-58662086 ATGAGAAATGCGTGAGGTGATGG - Intergenic
1158736074 18:60081416-60081438 ATGATAAATACTTGAGGTGATGG + Intergenic
1158843709 18:61417833-61417855 ATGATAAATACTTGAGGTGATGG + Intronic
1159369683 18:67515262-67515284 CTGAAAAATATTTGAAATGAAGG - Exonic
1159685415 18:71413118-71413140 ATGATAAATATTTGAAGTGATGG - Intergenic
1159790316 18:72771163-72771185 ATGAAAATTATGTGAACAAAAGG + Intronic
1163188273 19:15655891-15655913 ATGATAAACACATGAAGTGATGG - Intronic
1163216543 19:15882481-15882503 ATGATAAATATATGAAGTGATGG + Intronic
1163216547 19:15882599-15882621 ATGATAAATATATGAAGTGATGG + Intronic
1166009581 19:39932467-39932489 ATGACAAATGCTTGAAGTGAGGG + Intronic
1167784091 19:51622811-51622833 ATAAAAAAAAATTGAACTGATGG - Intronic
926586079 2:14687077-14687099 AGGAAAAAAACCTGAACTTATGG - Intergenic
928255782 2:29721069-29721091 AAGAAATATACCTGGACTGAAGG + Intronic
929041823 2:37751682-37751704 ATGAAATAGAGCTGAACTGAAGG - Intergenic
929178499 2:39007200-39007222 ATAAAAAAAAAGTGAACTAAAGG + Intronic
929937117 2:46301122-46301144 CTGAAAAAAACTTGAAATGATGG - Intronic
931102289 2:59015614-59015636 ATGAAAAATAGGTGAAGGGTGGG + Intergenic
931238551 2:60432627-60432649 AAGAGAAGAACGTGAACTGAAGG + Intergenic
931372467 2:61676615-61676637 ATGCAAAATAAGGAAACTGATGG - Intergenic
931631239 2:64302179-64302201 ATGAAAAATATTTGAGGTGATGG - Intergenic
933007067 2:77008231-77008253 AGGAAAATTACTTGAACTGGTGG + Intronic
935456815 2:103279208-103279230 ATGATGAATACATAAACTGATGG + Intergenic
935836046 2:107054932-107054954 ATGATAAATGCTTGAATTGATGG + Intergenic
936003325 2:108857734-108857756 GTGAAAAGTTAGTGAACTGAGGG + Intronic
936261614 2:110964785-110964807 ATGATAAATACTTGAGGTGATGG - Intronic
936585087 2:113749700-113749722 ATGAAAAATTCTGGAGCTGATGG + Intronic
936855259 2:116949998-116950020 ATGATAAATATGTGAGGTGATGG - Intergenic
937531342 2:122830967-122830989 ATGAAAAATAAGAGTAATGAGGG - Intergenic
937658713 2:124406662-124406684 ATGATAAATGCTTGAGCTGATGG - Intronic
939338965 2:140868730-140868752 ATGACAAATAGGTGATCTTATGG + Intronic
939360568 2:141166496-141166518 ATGATAAATGCTTGAAGTGATGG - Intronic
939518246 2:143196453-143196475 CTGATAAATATTTGAACTGATGG - Intronic
939544242 2:143533334-143533356 GGGCAAAATACGGGAACTGAAGG + Intronic
940016314 2:149109674-149109696 AGGGAACATAAGTGAACTGAAGG - Intronic
941201698 2:162519384-162519406 ATGAAAATTATGTGAACACATGG - Intronic
941527164 2:166620516-166620538 ATGAAAAATGCTTGAGGTGATGG - Intergenic
941851264 2:170184166-170184188 ATGATAAATACTTGAGGTGATGG - Intronic
941889850 2:170568746-170568768 GTGAAAATTGCGTGAACTGTGGG + Intronic
943483712 2:188454440-188454462 ATGTAAAATAGGTGAACAGTGGG + Intronic
943716131 2:191154173-191154195 ATTAAAAAGACGTGTACTTAAGG + Intergenic
945071630 2:205994806-205994828 ATGAAAAATACCTAAACTGTGGG + Exonic
945287409 2:208096316-208096338 ATGAAAAAGACATGAACATAGGG - Intergenic
945397772 2:209341352-209341374 ATGATAAATATGTGAACTGATGG - Intergenic
945748510 2:213749834-213749856 ATAAAAAACAGGTGAACTTATGG - Intronic
945790305 2:214295873-214295895 ATTAAAAATACATTAACTGAAGG - Intronic
946197749 2:218046163-218046185 ATGACAAATACTTGAGATGATGG - Intronic
947090425 2:226504193-226504215 ATGATAAATACTTAAAGTGATGG + Intergenic
947376154 2:229497835-229497857 AAGAAAAATTCAGGAACTGATGG + Intronic
948242799 2:236452385-236452407 ATGAAAAATATGTGGATGGAGGG + Intronic
948277620 2:236721698-236721720 ATGAGAAATACATGCAATGAGGG - Intergenic
1168855949 20:1009120-1009142 ATGAAAAATACCATAACTGGGGG + Intergenic
1168915765 20:1485265-1485287 ATGAAAAATACATGAGGTGATGG + Intronic
1169317530 20:4605331-4605353 ATGAGAAATATGTGAAGTGATGG - Intergenic
1169607918 20:7343734-7343756 ATGATAAATACTTGAGGTGATGG + Intergenic
1169837294 20:9894630-9894652 ATGATAAATACTTGAAGTGATGG + Intergenic
1170001087 20:11615069-11615091 ATGATAAGTATGTGAACTGGTGG + Intergenic
1170380225 20:15751157-15751179 ATGATGAATACGTGAGGTGATGG + Intronic
1170619496 20:17982874-17982896 ATGATAAATAGGTGAAGTGATGG - Intronic
1170657979 20:18307799-18307821 CTGAAAAATAAGTGAAATGAAGG - Intronic
1170733440 20:18993399-18993421 ATGAGAAAGACGAGCACTGAGGG - Intergenic
1173393252 20:42654132-42654154 ATGGAAACTATGTAAACTGAGGG + Intronic
1178045449 21:28688921-28688943 ATGAACAATACGTCAATTAATGG - Intergenic
1178810892 21:35880354-35880376 ATGATAAATAGGTGAAGTGATGG - Intronic
1180898511 22:19354329-19354351 AGGAAAAATGAGTGAAGTGAAGG + Intronic
1182971719 22:34585514-34585536 ATGACAAAGACATGAACTAAGGG + Intergenic
1203294037 22_KI270736v1_random:23202-23224 ATGAAATAGAGCTGAACTGAAGG - Intergenic
950818792 3:15735668-15735690 ATGAAAAAAAGGTTAACTGTGGG + Intronic
951060745 3:18204089-18204111 ATGATAAATACTTGAAGTGATGG - Intronic
951500852 3:23385097-23385119 ATGAAAAATACTTCTAATGATGG + Intronic
953519396 3:43626928-43626950 ATGAGAAATACAGGAACTGCTGG - Intronic
953870523 3:46622578-46622600 ATGCAAAAAAAGTGAACTGCAGG - Intronic
954102662 3:48388835-48388857 ATGATAAATATTTGAAGTGATGG - Intronic
954259571 3:49428939-49428961 AGGAAAAATGTGTTAACTGAAGG + Intronic
955041905 3:55325613-55325635 ATGCAAAATACCTGAAATGGAGG + Intergenic
955271535 3:57504704-57504726 AGGATAAATACTTGAAGTGATGG - Intronic
955289008 3:57673603-57673625 ATGATAAATGCTTGAAGTGATGG + Intronic
956190985 3:66608265-66608287 ATGTAACCTACTTGAACTGAAGG + Intergenic
956543330 3:70369779-70369801 ATGATAAATACTTGAGGTGATGG - Intergenic
956585545 3:70860736-70860758 AAGAAAAAGAAATGAACTGAGGG - Intergenic
957589993 3:82184350-82184372 CTGAAAAATCAGTAAACTGAAGG + Intergenic
957679336 3:83412093-83412115 CTCAAAAATACTTGAAATGAGGG - Intergenic
957743746 3:84310059-84310081 CAAAAAAATAAGTGAACTGATGG - Intergenic
957814814 3:85282921-85282943 ATGATAAATGCTTGAAGTGATGG + Intronic
957835375 3:85581829-85581851 AAAAAAAAAAGGTGAACTGAAGG + Intronic
958144839 3:89611774-89611796 ATGAAAAATCCTTAAACTTAGGG - Intergenic
958423705 3:93957579-93957601 ATGATAAATATTTGAAGTGATGG + Intronic
958669977 3:97191282-97191304 ATGATAAATACATGAGGTGATGG - Intronic
959038548 3:101393930-101393952 ATGATAAATACTTGAGGTGATGG - Intronic
959632161 3:108518908-108518930 ATGAAACATAAGTAATCTGAGGG + Intronic
960113393 3:113868022-113868044 AGAAAGAATACGTGAACTTAAGG - Intronic
961359560 3:126358244-126358266 AAGAAAAACACGTGGGCTGACGG + Intergenic
962221614 3:133569098-133569120 ATGGAGAATGTGTGAACTGAAGG - Intergenic
962638336 3:137355080-137355102 ATGATAAATGCTTGAAGTGATGG - Intergenic
963178209 3:142323988-142324010 ATGATAAATACTTGAGGTGATGG - Intronic
963653867 3:148020775-148020797 ATGATAAATACTTGAAGTAATGG + Intergenic
964175070 3:153818139-153818161 TTGAAAAATACATGAACTACAGG + Intergenic
964734665 3:159904266-159904288 ATGATAAATGCTTGAAGTGATGG - Intergenic
965546046 3:169917546-169917568 ATGATAAATACTTGAGGTGATGG - Intronic
966614169 3:181896527-181896549 ATGAAAAGTACATAAACTGAAGG - Intergenic
966986558 3:185185587-185185609 ATGATAAATGTTTGAACTGATGG - Intergenic
967277623 3:187791920-187791942 ATGAAAACTATCTGAAGTGAGGG - Intergenic
967628214 3:191710946-191710968 ATGATAAATACTTGAGGTGATGG + Intergenic
967944170 3:194789176-194789198 ATGATAAATACTTGAGGTGATGG - Intergenic
970074900 4:12206776-12206798 ATGATAAATTAGTGAAATGATGG - Intergenic
970355044 4:15243411-15243433 ATCAAAAAAAAGTGAACTTATGG - Intergenic
970617168 4:17779159-17779181 ATGAAAAACACAAGATCTGATGG + Intronic
972066673 4:34954248-34954270 ATGTAAAATACATAAACAGATGG - Intergenic
972232748 4:37094314-37094336 AGGAATAATATGTGAATTGAGGG + Intergenic
972458132 4:39274008-39274030 ATGAATAATACGTAAACGAATGG + Intronic
973127156 4:46601033-46601055 ATGATAAATACTTGAGGTGATGG + Intergenic
974362931 4:60906353-60906375 AGGAAAAACACTTGCACTGAAGG - Intergenic
974806902 4:66892331-66892353 ATGATAAATAAGTGAGGTGATGG + Intergenic
975409621 4:74034819-74034841 ATGATAAATATTTGAAATGACGG - Intergenic
975994549 4:80299250-80299272 ATGATAAATACATGAGATGATGG - Intronic
976161693 4:82207916-82207938 ATGATAAATACTTGAGGTGATGG + Intergenic
976442461 4:85090821-85090843 ATGATAAATATGTGAGGTGATGG + Intergenic
976491830 4:85679554-85679576 ATGAAAAATTAATGGACTGAGGG - Intronic
976917451 4:90394904-90394926 ATGATAAATATGTGAGGTGATGG - Intronic
976953737 4:90867502-90867524 ATGATAAATACTTGCAGTGATGG - Intronic
977223375 4:94365306-94365328 AGGATAAATACCTGAAGTGATGG - Intergenic
977293153 4:95184775-95184797 ATGAAAATTAATTGAAATGATGG + Intronic
978010009 4:103668946-103668968 ATGATAAATCCTTGAGCTGATGG - Intronic
978217839 4:106228200-106228222 AAGAAAAATACTTGAGGTGATGG - Intronic
978265288 4:106816422-106816444 ATAAAAAATAGGTTAACTTAGGG + Intergenic
978729961 4:112014048-112014070 ATTAAAAATATGTGTACTCATGG - Intergenic
979811757 4:125044771-125044793 ATGAAAAAAACCTGAATTGCTGG - Intergenic
979912745 4:126390159-126390181 ATAATAAATACTTGAAGTGATGG - Intergenic
979915330 4:126425202-126425224 ATGGTAAATAAGTGAAATGATGG + Intergenic
980207745 4:129743289-129743311 ATGAAATATATGTGAACCAAAGG - Intergenic
980481536 4:133394743-133394765 ATGTAAAATAGGTGAAGTGTGGG - Intergenic
980695507 4:136350254-136350276 ATGAAAAATATTTGAGATGATGG + Intergenic
981414848 4:144480884-144480906 ATGATAAATGCTTGAAGTGATGG + Intergenic
981591248 4:146364803-146364825 ATGAAAAATACTTGGAATGATGG + Intronic
981993340 4:150950993-150951015 AGGAGAAATATGTAAACTGAAGG + Intronic
982170755 4:152659540-152659562 ATGATAAATACTTAAAGTGATGG + Intronic
982691851 4:158557099-158557121 ATGATAAATACATGAGATGATGG + Intronic
983379629 4:166975470-166975492 ATGATAAATGCTTGAAGTGATGG - Intronic
983605802 4:169582237-169582259 AAAAAAAATACATGATCTGAGGG + Intronic
983903077 4:173157579-173157601 ATGATAAATACTTGAGGTGATGG + Intergenic
984209562 4:176829238-176829260 ATGATAAGTAAGTGAAGTGATGG + Intergenic
984586702 4:181572701-181572723 ATGACAAATGCTTGAGCTGATGG - Intergenic
984640663 4:182160846-182160868 ATGATAAATATTTGAAGTGAGGG + Intronic
984812819 4:183809830-183809852 ATGCAAAATAAGTGTACTAAAGG - Intergenic
986355692 5:6923337-6923359 ATGATAAATACTTGAAGTGCTGG + Intergenic
988152338 5:27400409-27400431 ATGATAAATACTTGAGCAGATGG + Intergenic
988231983 5:28491339-28491361 ATCATAAATAAATGAACTGAGGG + Intergenic
988249177 5:28732623-28732645 ATGAAAATTATGTGTATTGAAGG + Intergenic
988682801 5:33500594-33500616 ATGATAAATACTTGAAGTGATGG - Intergenic
989044739 5:37263767-37263789 ATGACAAATGCTTGAGCTGATGG - Intergenic
989348362 5:40454570-40454592 ATCTAAAATACTTGAACTAATGG - Intergenic
989362517 5:40619668-40619690 AGGAAAAATTCCTGAACTGGAGG - Intergenic
989455536 5:41639242-41639264 ATAAAAAATAAGTGGACTAATGG - Intergenic
989585419 5:43070855-43070877 ATGTAAAATAGGTGAAGTGTGGG - Intronic
989750740 5:44889995-44890017 ATGATAAATGCTTGAAGTGATGG - Intergenic
989815367 5:45729989-45730011 ATGAAAAATGCAAGAACAGATGG + Intergenic
990427413 5:55700550-55700572 ATAAAAAATAACTGAACTAAAGG + Intronic
990760354 5:59122552-59122574 ATGATAAATACTTGAGGTGATGG + Intronic
991226430 5:64278556-64278578 GTAAAATGTACGTGAACTGATGG + Intronic
992120989 5:73591921-73591943 ATGATAAATCCTTGAAGTGATGG - Intergenic
993537830 5:89108753-89108775 AAGAAAAATAATTGAACTCATGG + Intergenic
993846229 5:92947206-92947228 ATGATAAATACTTGAGGTGATGG - Intergenic
994340354 5:98619539-98619561 ATGAAAAATGCTTGAGATGATGG + Intergenic
994457810 5:100034693-100034715 ATGATAAATACTTGAGATGATGG + Intergenic
995256025 5:110047908-110047930 ATGAAAAAGATGTGAAGAGAGGG - Intergenic
995321770 5:110842725-110842747 TTGAAAAATCCTTGAACTTAGGG + Intergenic
996027886 5:118669389-118669411 ATGATAACTATGTGAAGTGATGG - Intergenic
996199602 5:120655152-120655174 ATAAAAAATAAGTGAGCAGAGGG - Intronic
996521651 5:124433992-124434014 ATGATAAATGCATGAAATGATGG + Intergenic
997671206 5:135674241-135674263 ATGATAAATACTCGAAGTGACGG - Intergenic
998204221 5:140147654-140147676 AAGACACATACGGGAACTGAAGG - Intergenic
998655019 5:144169193-144169215 GACAAAAATACATGAACTGAAGG - Intronic
998965613 5:147537497-147537519 ATAAAAAATAAATGAAATGAAGG - Intergenic
999022265 5:148180055-148180077 ACAAAAAATAAGTGAAGTGATGG - Intergenic
999185905 5:149708672-149708694 TTGAAAATAACGTGAACTGTTGG + Intergenic
999304225 5:150509336-150509358 ATGACAAATAAATGAAGTGAGGG + Intronic
1000572425 5:162931471-162931493 ATGATAAATACCTGAGATGATGG - Intergenic
1001506985 5:172287543-172287565 AAGACAAATACGTGAGGTGATGG - Intergenic
1002950215 6:1802299-1802321 ATCAATATTACTTGAACTGAAGG + Intronic
1003824641 6:9939781-9939803 ATGATAAATATGTGTATTGAGGG + Intronic
1003969847 6:11288693-11288715 ATGAAAGGTATGTGAACAGAAGG - Intronic
1005144766 6:22675949-22675971 ATGACAAGTATGTGAAGTGATGG + Intergenic
1007697319 6:43742148-43742170 ATGAAAGATTCGGGAGCTGAAGG - Intergenic
1008777360 6:55056799-55056821 ATGATAAATATTTGAAGTGATGG - Intergenic
1008849578 6:56008854-56008876 ATGATAAATTGGTGAAGTGATGG - Intergenic
1009577231 6:65481135-65481157 ATGATAAATGCTTGAAGTGATGG + Intronic
1009713568 6:67357042-67357064 ATAAAAACTATGTGAAGTGATGG - Intergenic
1009973014 6:70644831-70644853 ATGACAAAGGCCTGAACTGAGGG + Intergenic
1010127993 6:72456336-72456358 ATGATAAATGCTTGAAGTGATGG - Intergenic
1010566374 6:77419278-77419300 ATGATAAATGTTTGAACTGATGG + Intergenic
1012765929 6:103366713-103366735 ATGATAAATGCTTGAAGTGATGG + Intergenic
1012995225 6:105966120-105966142 ATGATAAATGCTTGAAGTGATGG + Intergenic
1013903394 6:115184537-115184559 ATGAAAAACTCTTGAAATGAAGG + Intergenic
1017167339 6:151421815-151421837 ATTAAAAATACTGCAACTGACGG + Intronic
1017264615 6:152428092-152428114 ATGCAAAAGACGTGAACTTGTGG - Intronic
1017427421 6:154337021-154337043 ATGATAAATACTGGAAGTGATGG + Intronic
1017622417 6:156313071-156313093 ATTAAAAATATGTGTACTCAAGG + Intergenic
1018436627 6:163765495-163765517 ATGAAAAATATGTGACCTTGAGG + Intergenic
1018590478 6:165414916-165414938 ATGAAAAATGCTCGAAGTGAGGG - Intronic
1018881466 6:167886462-167886484 AGGAAAAATACCTGAGCTGGAGG + Intronic
1021884164 7:25122049-25122071 ATGAGAAAGACCTGAAGTGAAGG - Exonic
1023574443 7:41610971-41610993 TTGAAAAAAACCTGAACTTATGG - Intergenic
1024280441 7:47714584-47714606 AAGAAAAATACTGGAAGTGAGGG - Intronic
1024689355 7:51782386-51782408 ATGATAAATGCTTGAAGTGATGG + Intergenic
1026257863 7:68728168-68728190 AGGATAAATACTTGAAGTGATGG + Intergenic
1027352205 7:77323838-77323860 ATAAAAAATACTGGATCTGAAGG + Intronic
1027404707 7:77847671-77847693 ATGATAAATGCTTGAAGTGATGG - Intronic
1027507218 7:79032047-79032069 ATGAAATATAGCTCAACTGAGGG - Intronic
1028118483 7:87029074-87029096 AAGAAAAATAAGGGAGCTGAGGG - Intronic
1028520696 7:91727283-91727305 ATGATAAATGTCTGAACTGATGG + Intronic
1030748182 7:113194521-113194543 ATAAAAAATAAGTTAACTGTAGG + Intergenic
1030949227 7:115768252-115768274 CTGCAAAGTACATGAACTGATGG - Intergenic
1031439382 7:121774330-121774352 ATGATAAATATGTGAGGTGAGGG + Intergenic
1031525104 7:122815985-122816007 ATGATAAATACCTGAGATGATGG - Intronic
1033767743 7:144512877-144512899 CTGAAAATTACGTGAAATAATGG - Intronic
1033774906 7:144598439-144598461 ATGATAAATACTTAAAGTGATGG + Intronic
1035913054 8:3589767-3589789 ATGACAAATATGTGAAGTAATGG + Intronic
1035942078 8:3912689-3912711 ATGCAGAATACGACAACTGATGG + Intronic
1035974625 8:4294307-4294329 ATAAATAATACGTGCACTGACGG + Intronic
1037306301 8:17507563-17507585 ATGAAAAATATTTGAAGTGATGG + Intronic
1037368887 8:18152010-18152032 ATGATAAATATTTGAAGTGATGG + Intergenic
1037424997 8:18746118-18746140 ATGTAAAATACGTGAAGGGTGGG - Intronic
1037492114 8:19406495-19406517 ATGATAAATAATTGAAATGATGG + Intronic
1039005355 8:33030496-33030518 AAGAAAATTACATGACCTGATGG + Intergenic
1039651398 8:39342818-39342840 ATAATAAATACGTGAGGTGAGGG + Intergenic
1040477482 8:47792633-47792655 ATGATAAATCCTTGAAGTGATGG + Intronic
1041516752 8:58708245-58708267 ATGATAAATATCTGAAGTGATGG + Intergenic
1043861825 8:85326498-85326520 CTGAAAAACACTTGACCTGATGG - Intergenic
1044189558 8:89298648-89298670 ATGATAAATACTTGAGGTGATGG + Intergenic
1045426314 8:102069208-102069230 ATGATAAATATGTGAGGTGATGG + Intronic
1045901577 8:107287599-107287621 ATGAAAAATACGTGAAAGAAGGG + Intronic
1046271507 8:111903253-111903275 ATGACAAGTAAGTGAAGTGATGG - Intergenic
1046489159 8:114925282-114925304 ATGAATAATAATTGAAGTGAGGG + Intergenic
1046654428 8:116877117-116877139 ATGATAAATACTTGAGGTGATGG + Intergenic
1046985627 8:120384846-120384868 ATGATAAATATTTGAAGTGATGG - Intronic
1047664036 8:127070400-127070422 ATAAAAAATATGTTAATTGACGG + Intergenic
1047818991 8:128497424-128497446 ATGAAAAATACTTCATCTCATGG - Intergenic
1048584856 8:135765848-135765870 AAGAAAAATAATTGAACTCATGG + Intergenic
1050784710 9:9386842-9386864 ATGAAATAAAAGGGAACTGAAGG + Intronic
1050873064 9:10599775-10599797 ATGAAAACTTCGAGAAGTGAAGG - Intronic
1050965190 9:11791607-11791629 TTGAAAAATAAATGAATTGAAGG - Intergenic
1051118289 9:13723020-13723042 ATGTTAAATACGTGAGGTGATGG + Intergenic
1051644976 9:19259064-19259086 ATGATAAACACTTGAAGTGATGG - Intronic
1051793786 9:20839765-20839787 ATGATAAATGCTTGAAGTGATGG - Intronic
1052477908 9:28984836-28984858 ATAATAAATACTTGAAGTGATGG - Intergenic
1052525141 9:29607954-29607976 ATGATAAATACTTAAGCTGATGG + Intergenic
1054915022 9:70487607-70487629 ATGATAAATACTTGAGGTGATGG + Intergenic
1058481936 9:105404625-105404647 ATGATAAATAAATGAACTTAGGG + Intronic
1058511725 9:105726098-105726120 ATGATAAATGCTTGAAGTGATGG - Intronic
1058930926 9:109718047-109718069 ACGAAAAATAAGGTAACTGAAGG - Intronic
1059079840 9:111236886-111236908 ATGATAAATACTTCAAGTGATGG + Intergenic
1059946140 9:119410205-119410227 ATGGAAAAGACTTGAACAGACGG - Intergenic
1059948611 9:119438718-119438740 ATGACAATGACGTGAACAGAAGG - Intergenic
1059997873 9:119931100-119931122 ATGATACATAAGTGAAGTGAAGG - Intergenic
1060601445 9:124880944-124880966 TTGAAAAATACGTGGCCTGTTGG + Intronic
1186840668 X:13481864-13481886 ATGATAAATGCTTGAAGTGATGG + Intergenic
1187349571 X:18500259-18500281 ATGATAAATGCTTGAAATGATGG - Intronic
1187656049 X:21475214-21475236 ATGATAAATGCTTGAAGTGATGG + Intronic
1187735831 X:22302873-22302895 ATGAAAAACAATTGAACTCATGG + Intergenic
1187735855 X:22303112-22303134 AGGACAAATACTTGAGCTGATGG + Intergenic
1187786823 X:22900235-22900257 ATGATAAATACTTGAAGTGACGG - Intergenic
1188049012 X:25461455-25461477 ATGATAAATACTGGAAGTGATGG + Intergenic
1188451819 X:30315435-30315457 ATGATAAATACTTGAGGTGATGG - Intergenic
1188628781 X:32324168-32324190 ATGATAAATACTTGAGATGATGG + Intronic
1189506865 X:41619900-41619922 ATGAAAAATACGTGAACTGATGG - Intronic
1189713813 X:43844140-43844162 ATGAAAAACTGGTAAACTGAGGG + Intronic
1189870598 X:45379096-45379118 ATGTTAAATAAGTGAAATGATGG + Intergenic
1190165898 X:48072524-48072546 ATGATAAAAATGTTAACTGAGGG + Intergenic
1190165944 X:48072839-48072861 AAGAAAAAAATGTTAACTGAGGG + Intergenic
1190364719 X:49680820-49680842 ATGATAAATGCTTGAAGTGATGG - Intergenic
1190506273 X:51129485-51129507 ATAAAAAATACAGGAGCTGACGG - Intergenic
1191953246 X:66617252-66617274 ATGAAAAAAAGGTGCACTTATGG - Intronic
1193055739 X:77147927-77147949 ATGATAAACACTTGAAGTGATGG + Intergenic
1193219087 X:78900858-78900880 ATGAAAGATACGAGAAAAGAAGG + Intergenic
1193618251 X:83717058-83717080 ATGATAAATGCATGAAATGATGG - Intergenic
1193826841 X:86236734-86236756 ATGAACAATATGTGGACTGCAGG + Intronic
1194227651 X:91280557-91280579 ATGTAAAATATGTGAAGTGTGGG + Intergenic
1194859850 X:98984397-98984419 ATGATAAATAGTTGAAGTGATGG + Intergenic
1195124584 X:101794259-101794281 ATGATAAATAGGTGAAGTGATGG - Intergenic
1195250054 X:103034754-103034776 ATGATAAATATATGAAGTGATGG - Intergenic
1195824403 X:108982491-108982513 ATGATAAATACTTGAAGTGGTGG - Intergenic
1196283486 X:113852211-113852233 ATGATAAATTCTTGAAGTGATGG - Intergenic
1196577461 X:117336316-117336338 ATGATAAATACTTGAGATGATGG - Intergenic
1197027558 X:121773156-121773178 ATGAAAAATTAGTGAGGTGATGG - Intergenic
1197444994 X:126542538-126542560 ATGCAAAATAAGTGAAATCAGGG + Intergenic
1197515699 X:127425698-127425720 ATGAAAGATATGGGCACTGATGG + Intergenic
1197788039 X:130220133-130220155 ATGATAAATACTTGAGGTGATGG - Intronic
1198298692 X:135311959-135311981 ATGATAAATACTTGAAGAGATGG - Intronic
1198316011 X:135467184-135467206 ATTAAAAATAATTGAACTCATGG + Intergenic
1198956921 X:142143064-142143086 ATTTAAAATAATTGAACTGATGG + Intergenic
1199921570 X:152410393-152410415 ATGAAAAATGCTTGAGGTGATGG + Intronic
1200341758 X:155404466-155404488 ATCAGAAAAACCTGAACTGAGGG + Intergenic
1200406802 Y:2820251-2820273 ATGATAAATACTTGAGATGATGG - Intergenic
1200694463 Y:6346586-6346608 ATGATAAGTGCTTGAACTGAAGG - Intergenic
1200941561 Y:8787322-8787344 ATGATAAGTGCTTGAACTGAAGG + Intergenic
1201040814 Y:9828124-9828146 ATGATAAGTGCTTGAACTGAAGG + Intergenic