ID: 1189513207

View in Genome Browser
Species Human (GRCh38)
Location X:41684385-41684407
Sequence AACCCTGGGCAAACCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189513203_1189513207 9 Left 1189513203 X:41684353-41684375 CCAAAGTACATAACGAGATCTAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1189513207 X:41684385-41684407 AACCCTGGGCAAACCCAAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1189513202_1189513207 13 Left 1189513202 X:41684349-41684371 CCTGCCAAAGTACATAACGAGAT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1189513207 X:41684385-41684407 AACCCTGGGCAAACCCAAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189513207 Original CRISPR AACCCTGGGCAAACCCAAAG AGG Intronic
900370445 1:2329744-2329766 GACCCTCGACAGACCCAAAGGGG - Intronic
906940814 1:50253495-50253517 AACCCTGGACAAAACCACAGTGG - Intergenic
907797931 1:57736267-57736289 AACGGTGGGGAAACACAAAGAGG + Intronic
910761334 1:90735165-90735187 AACTGTGTGCAAACACAAAGGGG - Intergenic
912117116 1:106419989-106420011 AACCCTGGACAAACCAAAATTGG + Intergenic
912323691 1:108738294-108738316 ATCCCTGAGCAAAACCAAGGAGG - Intronic
920162614 1:204010853-204010875 AACCATGGCCAAAGGCAAAGGGG - Intergenic
923627498 1:235626087-235626109 AACCCTGAGAATACACAAAGCGG - Intronic
1063996508 10:11625159-11625181 CCCCCTGGGAAAACCCCAAGGGG - Intergenic
1064149619 10:12851816-12851838 AACCCTACTCAAACTCAAAGTGG + Intergenic
1067137208 10:43620784-43620806 AAGCCTGTCCAAACTCAAAGGGG + Intergenic
1067405456 10:46019203-46019225 AACCCTGGACACACCAACAGTGG + Intronic
1071833193 10:89392516-89392538 AAACCTAGGGAAACCGAAAGGGG - Intronic
1071854780 10:89613167-89613189 AACACAGAGCAAACCCAAATGGG + Intronic
1075529506 10:123217200-123217222 AAAGCTGAGCAAACCCAAACAGG - Intergenic
1076489644 10:130849284-130849306 CACACTCAGCAAACCCAAAGCGG + Intergenic
1077736383 11:4796044-4796066 AATTCTGGGCAAACTCAGAGTGG - Intronic
1078438680 11:11346086-11346108 TACACTGGGCAAATCAAAAGAGG - Intronic
1080760020 11:35239916-35239938 AACCCAGGGGAAACCCAGTGTGG + Intergenic
1084070979 11:66734466-66734488 AACACTGGGGAAACTCTAAGAGG - Intergenic
1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084884700 11:72196051-72196073 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG + Exonic
1085189231 11:74603486-74603508 CATCCTGGGCAAACCCAGGGTGG - Intronic
1085514992 11:77106687-77106709 AACCATGGGCAAACTCAGGGAGG - Intronic
1093339168 12:17950073-17950095 ATCCCAGGGCTAAGCCAAAGTGG + Intergenic
1095607734 12:44090327-44090349 AACCCTGGAGAATCCAAAAGTGG - Intronic
1096661682 12:53129171-53129193 AACACTAGGCAAAATCAAAGGGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102058260 12:109912972-109912994 CTCCCTGGGCAAACACAAAAGGG - Exonic
1103223387 12:119265804-119265826 AACCCTGGGGATGCCAAAAGTGG + Intergenic
1106949510 13:34867368-34867390 CACCCTGGGGAAAGCCACAGGGG + Intergenic
1106979047 13:35255932-35255954 AACTCTTGGGAGACCCAAAGTGG + Intronic
1107592811 13:41926151-41926173 AACCCTGGGAAAACCAAGAAGGG + Intronic
1108682271 13:52790483-52790505 AACCCTTGGCAAAGGCACAGGGG - Intergenic
1115653152 14:35417888-35417910 AAGACTGGGAACACCCAAAGAGG + Intergenic
1118896591 14:69950315-69950337 CACACTGGCCAAACTCAAAGAGG - Intronic
1119782690 14:77288072-77288094 AAACCTAGGCTCACCCAAAGTGG - Intronic
1123988487 15:25665740-25665762 AGCTCTGGGTACACCCAAAGGGG - Intergenic
1124258771 15:28167686-28167708 AACCATGACCAAAACCAAAGAGG - Exonic
1124814887 15:32979972-32979994 ATCCCTGGTAAAACTCAAAGTGG - Intronic
1127930672 15:63595259-63595281 AGCTCTGGACAAGCCCAAAGGGG + Intergenic
1138347911 16:56331295-56331317 AACCCTGGGCACATCCAACCAGG + Intronic
1141092325 16:81138698-81138720 ATCCCTGGGGAACCCCTAAGGGG - Intergenic
1144011856 17:11156451-11156473 AAGCCTTGGCAAACCCAATGAGG - Intergenic
1144667720 17:17113041-17113063 AACCCTGGGGAGTCCCCAAGTGG - Intronic
1149222601 17:54432964-54432986 AATCCTGGGGAGACCCACAGAGG - Intergenic
1149267796 17:54946538-54946560 AACCACAGGCAACCCCAAAGTGG - Intronic
1152009619 17:77703999-77704021 AACCCTGAGAAAAACCAAAAAGG + Intergenic
1154163683 18:11998280-11998302 AACCCCAGGAAAACCCAAACAGG - Intronic
1155948429 18:31882434-31882456 GACACTGGGCACACCAAAAGGGG + Intronic
1156555924 18:38068294-38068316 AAGCCTGATCAAAGCCAAAGTGG + Intergenic
1157010528 18:43643265-43643287 AACCCTGTCCAAACCCCAAAAGG + Intergenic
1158087807 18:53673805-53673827 AGCCCAGGCTAAACCCAAAGTGG - Intergenic
1158750055 18:60248212-60248234 AACCCAGGGCACTCCCATAGGGG - Intergenic
1159308638 18:66678908-66678930 AACCCTGGGCTCACCCATATTGG - Intergenic
1165244617 19:34491246-34491268 AACAGTGGGCAAACCAAGAGTGG - Intronic
925923174 2:8651709-8651731 AACCCTGGGGATACAAAAAGAGG + Intergenic
926758652 2:16256850-16256872 ATCCCTGGACACACACAAAGTGG - Intergenic
926802119 2:16667524-16667546 AAACCTGGCCAAACTCAAGGTGG - Intergenic
928081891 2:28319286-28319308 AACTCTGCACCAACCCAAAGGGG - Intronic
929029247 2:37635546-37635568 AACCCAGAGCAAACCCAGAAAGG - Intergenic
932658589 2:73632037-73632059 ATGCCTGGGAAAACACAAAGAGG - Intergenic
936498000 2:113039294-113039316 AACTCAGGGAACACCCAAAGAGG + Intronic
938582587 2:132660613-132660635 TACCCTGGGAACACCAAAAGAGG - Intronic
941526803 2:166616062-166616084 CACCCTGGGCAAACAGAAAGAGG - Intergenic
942227415 2:173829525-173829547 AACCATAGGCACATCCAAAGGGG - Intergenic
946417966 2:219550075-219550097 AACCCTGAGCACACCCCAATGGG - Exonic
947054975 2:226089707-226089729 AACATTGGGCAAAACAAAAGGGG - Intergenic
947975668 2:234363756-234363778 AACCCAGGGCAAAGCAGAAGAGG + Intergenic
948766647 2:240225451-240225473 AACCCTGGGTGAACCCAAGCAGG - Intergenic
1175650190 20:60715248-60715270 AACCCAGAGCAGACGCAAAGTGG + Intergenic
1175700134 20:61130926-61130948 GACCCTGTGGAAACCCAGAGTGG + Intergenic
1182480926 22:30608234-30608256 GACCCTGGGGAAACCCTGAGAGG + Intronic
1183046392 22:35223915-35223937 AACCCTGGCAAAACCAAAACTGG + Intergenic
1185249036 22:49789934-49789956 ACCCCTGGTCTATCCCAAAGCGG + Intronic
949236024 3:1809067-1809089 AAACCTGAGCAAACACAAATAGG + Intergenic
950989661 3:17419373-17419395 AACCATAGGCATATCCAAAGAGG - Intronic
956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG + Intergenic
957919787 3:86732609-86732631 AAGGCGGCGCAAACCCAAAGAGG + Intergenic
958954361 3:100451337-100451359 AAAGGTGGGAAAACCCAAAGTGG + Intronic
962495097 3:135931672-135931694 AAGCCTGGGCAAACATAAGGAGG - Intergenic
968972252 4:3802181-3802203 AACCCTGGGGCACCCCAAGGAGG + Intergenic
969983179 4:11179810-11179832 ATCCCTGGGAAAACCCAACTGGG + Intergenic
970549591 4:17166003-17166025 AACCCTGAGCCAACCCACAGTGG - Intergenic
977468514 4:97412580-97412602 AAACCTGGTCCAACTCAAAGAGG - Intronic
979121908 4:116913992-116914014 AACCATGGGGAAAGGCAAAGGGG - Intergenic
981722849 4:147818915-147818937 AACTCTGGTAAAACCCTAAGAGG + Intronic
982556209 4:156868514-156868536 CATCCTAGGAAAACCCAAAGAGG + Intronic
985369692 4:189272883-189272905 AACCCTGCCTAAACCCACAGAGG + Intergenic
985802561 5:2014463-2014485 AACCCTCGGCACACCCAGGGTGG + Intergenic
986335297 5:6750585-6750607 AAACCTGAGCAAAACCAAGGGGG - Intronic
986945021 5:13007168-13007190 AACCCTGAGCAGACCAAAAATGG + Intergenic
989512847 5:42308588-42308610 AACCATTAGCAAAGCCAAAGAGG - Intergenic
990190840 5:53258722-53258744 AACACTGGGGACACCAAAAGTGG + Intergenic
993598325 5:89887956-89887978 AAGCCTGGGCAAAACCTATGAGG + Intergenic
995851236 5:116548080-116548102 AAGACTGGTCAACCCCAAAGTGG - Intronic
998546569 5:143033282-143033304 AACGCTGGGAAAACCAAAGGAGG + Intronic
1000586837 5:163110686-163110708 AACCCTGGGCAAAACTGAAGTGG + Intergenic
1000959212 5:167579310-167579332 AACCCTCTGCAAACACACAGTGG - Intronic
1003850533 6:10218007-10218029 AACCCTGAGCAAATGCCAAGCGG + Intergenic
1007356804 6:41325876-41325898 AATCCTGAGCCAACCCACAGAGG + Intergenic
1007701252 6:43767855-43767877 ATCCCTGGGCAAAGCCCCAGAGG + Intergenic
1008235202 6:49038103-49038125 TAACCTCTGCAAACCCAAAGAGG - Intergenic
1008862608 6:56168155-56168177 ATCAATGGGCAAACCCAAATTGG - Exonic
1013399954 6:109783722-109783744 ACTCCTGAGCAAAACCAAAGGGG - Intronic
1014289642 6:119543411-119543433 AACCCAGAGCAAACACAAACTGG - Intergenic
1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG + Intronic
1021450281 7:20778077-20778099 GACCTTGGGCAAACCCACGGTGG - Intergenic
1024558084 7:50621079-50621101 AACCCTGAGGAGAGCCAAAGAGG + Intronic
1024813513 7:53241060-53241082 AACATTAGGCAAACCCAAATTGG - Intergenic
1028851254 7:95540563-95540585 AACCCTGGGCAAAGCAACAGAGG + Intergenic
1028976138 7:96916420-96916442 AGCCCTGGTCAGTCCCAAAGGGG + Intergenic
1031635004 7:124091811-124091833 TATCCTGGGCAAAACCCAAGGGG + Intergenic
1032800808 7:135316142-135316164 AAACCTGGACAAACCCACTGGGG - Intergenic
1034113739 7:148563742-148563764 GACTCTGGTAAAACCCAAAGGGG - Intergenic
1035544094 8:466226-466248 CACACTGGGCAAACCCACGGCGG - Intronic
1036088429 8:5638328-5638350 AAACCTGGGCAAAGTCAACGTGG + Intergenic
1036286423 8:7447573-7447595 AACCCTCTGCCAACCCTAAGAGG - Intronic
1036335053 8:7863955-7863977 AACCCTCTGCCAACCCTAAGAGG + Intronic
1037842348 8:22254097-22254119 AACACTGGGCACTCCAAAAGGGG - Exonic
1039058389 8:33554597-33554619 AACCCTGGGCAATCCCAGCTGGG + Intronic
1041890766 8:62865615-62865637 AACCCTGCCAAAACACAAAGGGG - Intronic
1042937573 8:74075976-74075998 AAACCTTGGCAAACCCAGAGTGG + Intergenic
1047661045 8:127037200-127037222 CACCCTGTGCAAAAGCAAAGAGG + Intergenic
1047911858 8:129538982-129539004 TGCACTGGGCATACCCAAAGGGG - Intergenic
1051889031 9:21924618-21924640 AGCCCTGGGTAAACCCAATGAGG - Intronic
1059807222 9:117815478-117815500 CACCCAGGTCAAACCCACAGAGG - Intergenic
1062385460 9:136309287-136309309 AACCCTGGGCAGGCCCAAGCAGG + Intergenic
1203445478 Un_GL000219v1:50663-50685 AACCCTGCCTAAACCCACAGAGG + Intergenic
1185827991 X:3271367-3271389 ATCCCTGAGCTAAGCCAAAGGGG - Intergenic
1186323009 X:8451163-8451185 AACCCTGTGCAAAGCTGAAGAGG + Intergenic
1186548004 X:10471257-10471279 AGTCCTAAGCAAACCCAAAGAGG + Intronic
1186709524 X:12178800-12178822 AAGCCTGTGGAATCCCAAAGGGG + Intronic
1187000025 X:15167099-15167121 AACACTGTGCAAACATAAAGAGG - Intergenic
1189145324 X:38649631-38649653 GACCCTGGGGAAACCCAACTCGG - Intronic
1189513207 X:41684385-41684407 AACCCTGGGCAAACCCAAAGAGG + Intronic
1190152057 X:47957155-47957177 AACCCTGGGCCAACCTGAATAGG + Intronic
1190160603 X:48028994-48029016 AACCCTGGGCCAACCTGAATAGG - Intronic
1194147428 X:90280871-90280893 AACTCTGTGCAAACCCAATAAGG + Intergenic
1200493828 Y:3857633-3857655 AACCCTGTGCAAACCCAATAAGG + Intergenic