ID: 1189520985

View in Genome Browser
Species Human (GRCh38)
Location X:41767730-41767752
Sequence CTTGCCTAGGTCAGGGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189520978_1189520985 7 Left 1189520978 X:41767700-41767722 CCTCAATTTGGGTTTGTCTGATG 0: 28
1: 157
2: 365
3: 589
4: 1057
Right 1189520985 X:41767730-41767752 CTTGCCTAGGTCAGGGTTATGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1189520975_1189520985 28 Left 1189520975 X:41767679-41767701 CCAAGTATTTTATAGAATGTTCC 0: 1
1: 0
2: 17
3: 98
4: 472
Right 1189520985 X:41767730-41767752 CTTGCCTAGGTCAGGGTTATGGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189520985 Original CRISPR CTTGCCTAGGTCAGGGTTAT GGG Intronic
903181264 1:21606078-21606100 CTTGGCCAGGTCGGGGTTGTTGG + Exonic
907678933 1:56545572-56545594 CTTCCCTATGTCAGGGTTCCGGG - Intronic
908974363 1:69879888-69879910 CCTGCCTTGGTCAGGGTGAACGG + Intronic
914396869 1:147278052-147278074 CTTGCCCAGCTCATGGTTATCGG + Intronic
921813372 1:219539673-219539695 CTTTCCTTGATCAAGGTTATTGG - Intergenic
922104910 1:222505247-222505269 CATGCATAGGTCAGGGTCTTAGG - Intergenic
923076255 1:230611306-230611328 CTTGCCTAGCTCAGGGTCAAAGG - Intergenic
924347087 1:243082767-243082789 CATGCATAGGTCAGGGTCTTAGG - Intergenic
1063032294 10:2247740-2247762 CTTCTCTAGGTCTGGCTTATTGG - Intergenic
1066729263 10:38422108-38422130 CATGCGTAGGTCAGGGTCTTAGG + Intergenic
1068197230 10:53732412-53732434 CTTGGCAGGGGCAGGGTTATGGG + Intergenic
1071847644 10:89536132-89536154 CTTGCCGAGGTCAGGGGTCATGG - Intronic
1072009554 10:91291353-91291375 CTGGAATAGGTGAGGGTTATGGG - Intergenic
1072186140 10:93040930-93040952 CTCACCTAGGTCAGGAGTATAGG - Intronic
1074771312 10:116736388-116736410 CTTGCCTAGGTTTGGGGTGTTGG - Intronic
1077541979 11:3150999-3151021 CTTTCCAAGGTCAGGGTCACAGG - Intronic
1078072362 11:8124320-8124342 CTTGCATATGTGAGGGATATTGG - Intronic
1080053521 11:27881590-27881612 CCTGCCTGGATCAGGGTTGTGGG - Intergenic
1084571753 11:69963909-69963931 CTGGCCTTGGACAGAGTTATTGG - Intergenic
1084712559 11:70853008-70853030 CTTCCCCAGGGCAGGGTTGTGGG - Intronic
1089616878 11:119699775-119699797 GTTGCCAAGGTCACGGTTAGTGG + Intronic
1092569681 12:9708734-9708756 CTTGCCAAGGTCAAGGTCACTGG + Intergenic
1101414774 12:104499507-104499529 CTTGCTGAGGCCAAGGTTATAGG - Intronic
1101828482 12:108239359-108239381 CTTGACTAGGTCAGTGATTTTGG + Intronic
1118292667 14:64540613-64540635 CTTGCCTAGGTCGGAGTGACTGG - Intronic
1118753189 14:68821151-68821173 CTTGCCTGGATCAGGGTGACTGG - Intergenic
1120233744 14:81867606-81867628 CTTTTCTAGGTCACGGGTATTGG - Intergenic
1120947245 14:90010046-90010068 CTTGCCTACTTCAAGGTTGTAGG - Intronic
1125836035 15:42752306-42752328 CTTGACTAGGTCTGGCTGATAGG + Exonic
1138070152 16:53984783-53984805 CTTGACTAAGTCAGTGATATTGG + Intronic
1139003873 16:62547511-62547533 CATGGCTAGGTCAGGCTTAGAGG - Intergenic
1142680576 17:1545790-1545812 CCTGCCTGGGGCAGGGTTCTGGG - Intronic
1143847168 17:9781330-9781352 CATGCCTATGTCAAGGTCATTGG + Intronic
1149314353 17:55424245-55424267 GTTGCCTAGGGCAGGGGAATGGG + Intergenic
1149852020 17:60043359-60043381 CTGGCCATGGTCAGGGTTGTTGG - Exonic
1150648858 17:66996992-66997014 CCTGCGGAGCTCAGGGTTATTGG + Intronic
1151316053 17:73323419-73323441 CAAGGCTAGGTCATGGTTATGGG - Intergenic
1152420385 17:80189693-80189715 CTTGCCTAGGGCAGGCCTCTGGG + Intronic
1152971226 18:163166-163188 CTTGATTAGGTAAGTGTTATGGG + Intronic
1153492631 18:5665097-5665119 CTTGCCTAGCTCAGGGCTACAGG + Intergenic
1154009604 18:10563848-10563870 CTTGACCACGTCAGGGTTGTTGG - Intergenic
1158440900 18:57473354-57473376 TTTGCCTAGCTCAGAGTTACTGG + Intronic
1158872158 18:61698791-61698813 CCTGCCTTGGCCAGGATTATAGG + Intergenic
1166308674 19:41949987-41950009 CTTGTCTAGGTTGGGGTGATGGG - Intergenic
1168013429 19:53553251-53553273 GTTGCCTAGGCCAGGATTACAGG - Intronic
925670893 2:6309010-6309032 CTTGCCTAGGACATGGTTTCTGG - Intergenic
926022293 2:9507088-9507110 CTTGCCTAGTAGAGGGTGATGGG + Intronic
927861063 2:26560441-26560463 CTTGGCTAGGGCAGGATCATGGG - Intergenic
935671252 2:105559069-105559091 TCTGATTAGGTCAGGGTTATTGG - Intergenic
935760462 2:106315873-106315895 CCTGCTGAGGTCAGGGTCATAGG + Intergenic
938161502 2:128988527-128988549 CTTGGCTAGTGCAGGGTTCTTGG + Intergenic
941042492 2:160638281-160638303 CTTGCCTAGGTAAGGGAGGTAGG + Intergenic
942076041 2:172358070-172358092 CTTGCCCTGGTCAGGGTTTGGGG + Intergenic
943308611 2:186298850-186298872 CTTGCCTTTGTCATGGTTACTGG - Intergenic
1172494376 20:35368343-35368365 AATGCCTACCTCAGGGTTATTGG - Intronic
1177471586 21:21566754-21566776 CTTGCCCAGCTCAGTGTTTTGGG + Intergenic
1182995866 22:34811862-34811884 CTTAATTAGGTTAGGGTTATGGG - Intergenic
1184584796 22:45440671-45440693 CTTGCCTGGGACAGGGTGAGGGG + Intergenic
1185050384 22:48551205-48551227 CTTGTCCAGGTCAGGGTCAGGGG - Intronic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
955740168 3:62082110-62082132 CTTGCCTAGGCCTGGGCTTTTGG - Intronic
956534688 3:70262695-70262717 CTTGCCTTGCTTGGGGTTATTGG + Intergenic
957595499 3:82259859-82259881 TTTGCAAAGGTCTGGGTTATTGG - Intergenic
963090625 3:141480472-141480494 CCTGCCTAGGCCAGGGCTATTGG - Intergenic
964080234 3:152745385-152745407 CTTGACTAGGCCAGGATTAAGGG - Intergenic
970655952 4:18230045-18230067 CTTACCTTGGGCAGGGTTCTCGG + Intergenic
971757016 4:30719277-30719299 CTTGGTTAGGACATGGTTATCGG - Intergenic
974278167 4:59754470-59754492 CTTACCTATGTCAGGGTTTAAGG + Intergenic
974459831 4:62173103-62173125 CTTGACTATGTCAAGGTTTTGGG - Intergenic
976629796 4:87224587-87224609 CCTGTCCAGGTCAGGGTTACTGG + Intronic
977343165 4:95786317-95786339 CTATTCTAGTTCAGGGTTATGGG + Intergenic
979255631 4:118604912-118604934 CATGCATAGGTCAGGGTCTTAGG + Intergenic
979332710 4:119435605-119435627 CATGCATAGGTCAGGGTCTTAGG - Intergenic
979870094 4:125808568-125808590 TTTGCCAAGGTCAGGCTTTTAGG - Intergenic
988732919 5:33991291-33991313 GTGGCCTTGGTCAGGGTCATGGG - Intronic
995357170 5:111252057-111252079 CTGGGCTAGGGCAGAGTTATGGG + Intronic
995833118 5:116375272-116375294 CTCGCCTAGCTCAGGGACATTGG + Intronic
995868233 5:116716105-116716127 CTTCCCTAGGACACGTTTATTGG - Intergenic
999721581 5:154402576-154402598 CTTCCCTAGGCCAGGGATTTGGG + Intronic
1000007834 5:157203922-157203944 TTTGGCTACCTCAGGGTTATGGG + Intronic
1000068142 5:157714332-157714354 CTTACATAGGTCAGGGTGAATGG - Intergenic
1002660660 5:180789264-180789286 GTTGCCTAGCCCAGGGTTTTTGG + Intergenic
1004753065 6:18583467-18583489 CTGGCCTAGGGCAGGGATATAGG + Intergenic
1005999977 6:30956907-30956929 CTTGCCAGGGGCAGGGTTCTGGG - Intergenic
1006921654 6:37631651-37631673 CTTGCCAAGGTCATGGGGATAGG - Exonic
1008059771 6:46984932-46984954 CTTGCCTGTGGCAGGCTTATGGG + Intergenic
1015465096 6:133540202-133540224 CTGTCATAGGTCAGGGTTATAGG - Intergenic
1016879810 6:148899929-148899951 CTTGCCTAGGTGTATGTTATTGG + Intronic
1022521472 7:31010258-31010280 CTGGCCTAGGACAGGGTTTCTGG - Intergenic
1023397711 7:39766754-39766776 CATGCATAGGTCAGGGTCTTAGG + Intergenic
1024071321 7:45788055-45788077 CATGCATAGGTCAGGGTCTTAGG + Intergenic
1025134960 7:56403737-56403759 CCTGCATAGGTCAGGGTCTTAGG - Intergenic
1025909097 7:65813028-65813050 CCTGCATAGGTCAGGGTTGTAGG + Intergenic
1027204762 7:76089017-76089039 CCTGCATAGGTCAGGGTTGTAGG - Intergenic
1028394491 7:90352487-90352509 CTCACCTAGGTGATGGTTATTGG + Intronic
1030194589 7:106841143-106841165 CCTGTCTAGGTCAAGGTAATGGG - Intergenic
1031896658 7:127357532-127357554 CTTGCCTAGATCAGAGGCATGGG + Intronic
1033444760 7:141410563-141410585 CTTTCCCAGGTCAGGGTAATGGG + Intronic
1035028663 7:155843674-155843696 CTGGCCTAGGCCAGGGCTGTGGG + Intergenic
1043123357 8:76359653-76359675 CTTTCCTAAGTCAGTGTTATTGG - Intergenic
1043566992 8:81559469-81559491 CTTTTCTAGGCCAGGGTGATCGG + Intergenic
1044898016 8:96913401-96913423 CTTCCCTAGCTCAAGGTTGTGGG + Intronic
1044993636 8:97818403-97818425 CTTGCCTAGGCCAGTGATGTAGG + Intronic
1048842745 8:138579638-138579660 CTTGCCTAGGCCAGGCTCAGTGG - Intergenic
1049622462 8:143604851-143604873 CGTGCCTAGGTCAGGGGTCCTGG - Exonic
1057249778 9:93491359-93491381 CTTGCCTGGGTCAGGTTTGGTGG + Intronic
1059725739 9:117006543-117006565 CTTGCCTAGATTAGAGTAATAGG + Intronic
1061913418 9:133737172-133737194 TGTGCCTAGGACAGGGTTCTGGG - Intronic
1062011255 9:134268048-134268070 GTTGCCAAGGTCAGGGTAAGCGG - Intergenic
1187230418 X:17416245-17416267 CTTGTATAGGTGAGGGTTATAGG - Intronic
1187525719 X:20052873-20052895 CTTGCCTCGGTCTGGGGAATAGG + Exonic
1188373820 X:29402870-29402892 CATGATTAGGTGAGGGTTATAGG + Intronic
1189520985 X:41767730-41767752 CTTGCCTAGGTCAGGGTTATGGG + Intronic
1195668792 X:107452207-107452229 TGTGCCTAGGCCAGAGTTATGGG + Intergenic