ID: 1189523035

View in Genome Browser
Species Human (GRCh38)
Location X:41790236-41790258
Sequence CAACTTTAGCACCTGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189523032_1189523035 -10 Left 1189523032 X:41790223-41790245 CCATCAGCTCGTTCAACTTTAGC 0: 8
1: 22
2: 10
3: 9
4: 67
Right 1189523035 X:41790236-41790258 CAACTTTAGCACCTGGAGATGGG 0: 1
1: 0
2: 0
3: 16
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189523035 Original CRISPR CAACTTTAGCACCTGGAGAT GGG Intronic
905011207 1:34748128-34748150 CACTTTTAGCACCTGGAGCCTGG - Intronic
905298158 1:36967740-36967762 CAACTTTACCACCTATAGACAGG + Intronic
905744992 1:40408004-40408026 CAACTTTAGCAACTGGATTTGGG - Intronic
906251709 1:44315496-44315518 CAACTCTCCCACCTGGAGCTGGG + Intronic
908783178 1:67710430-67710452 AAACTTTATGCCCTGGAGATTGG - Intronic
909515497 1:76502677-76502699 CAACTTCAGAAAGTGGAGATAGG - Intronic
918231565 1:182538029-182538051 CCACTTTACCACCTTGAGGTAGG - Intronic
919026321 1:192175880-192175902 CAACTTTAGTACTTGCAAATAGG + Intronic
1063976916 10:11424724-11424746 CAGCTTTAGAAGCTGGAGAGGGG - Intergenic
1065189538 10:23197100-23197122 CCACTTCTGCACCTGGAGCTGGG + Intergenic
1067769134 10:49110936-49110958 CACCTTCAGCACCAGGAGGTGGG + Intronic
1071541588 10:86489768-86489790 CCTCTTTACCACCTGGAAATGGG + Intronic
1075602457 10:123780352-123780374 CAACGTTAGAAGCTAGAGATTGG - Intronic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1076236917 10:128870777-128870799 CAACGTTTGGTCCTGGAGATGGG + Intergenic
1078101050 11:8330495-8330517 AAACTTTAGCAGCTGCAGATGGG - Intergenic
1083649920 11:64196730-64196752 CAAATTTAGCACCTTGAAATGGG + Intronic
1086538839 11:87883607-87883629 CAAGTTAAGGACCTTGAGATGGG + Intergenic
1086885437 11:92200227-92200249 TAAATTAAGCACCTTGAGATGGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088844453 11:113652978-113653000 TAGCTTGAGCACCTGGAGATTGG - Intergenic
1089719427 11:120399552-120399574 CAACTGTAACACCTGAAGGTAGG + Intronic
1089730120 11:120513958-120513980 GAACTTTAGTACCGGGAGAGAGG + Intronic
1092310404 12:7345595-7345617 CAACTTTAGAACTTGGTAATAGG - Intergenic
1092781838 12:11994806-11994828 CAACTTTTGCCCTTGGAGAAAGG - Intergenic
1095866984 12:46983238-46983260 CAACAATAGCACATGGAGACTGG - Intergenic
1097091600 12:56509831-56509853 CAACTTTAGAAGCTGGGCATGGG - Intergenic
1100208272 12:92375065-92375087 CATCAGTAGCACCTGGAAATTGG - Intergenic
1100845858 12:98656784-98656806 ATACTTTAGCACCAGGAAATGGG + Intronic
1103336527 12:120194435-120194457 CGACTTCAGCAGCTGGAGCTCGG - Intronic
1104094355 12:125543242-125543264 CAAATGCAGAACCTGGAGATAGG - Intronic
1105831427 13:24165598-24165620 CAACTTTAGCAGCAGGAAAGGGG + Intronic
1108900377 13:55397266-55397288 CAACTTTAGCCCAGGGAGAAAGG + Intergenic
1109176320 13:59161334-59161356 CATCTTGAGAACCTGGAGGTGGG - Intergenic
1109710879 13:66158327-66158349 CAACTTTAACACTTTAAGATAGG - Intergenic
1110009842 13:70318188-70318210 CAACTTTACCACCTAGAGTATGG + Intergenic
1112377667 13:98858811-98858833 CTTCTTTAGAACTTGGAGATAGG - Intronic
1116587111 14:46720430-46720452 TAACTTAAGCATCTTGAGATGGG - Intergenic
1117662544 14:58022341-58022363 TGACTTAAGGACCTGGAGATGGG - Intronic
1117713913 14:58561076-58561098 CAACTTTAGCACTTGGAAAATGG - Intergenic
1117940484 14:60959072-60959094 CCACTTAGGCACCTGGAGATTGG + Intronic
1118375991 14:65177588-65177610 CAACCTTACCACGTGGAGAGAGG + Intergenic
1120680260 14:87472280-87472302 GGACTGTAGCACTTGGAGATGGG - Intergenic
1120877792 14:89390982-89391004 TAACCTTAGCAACTGGAGAAAGG - Intronic
1120908683 14:89644951-89644973 CAATTTGCTCACCTGGAGATGGG - Intergenic
1121938576 14:98044755-98044777 CAACTTCACCACCTGCAGACTGG + Intergenic
1130518618 15:84645355-84645377 CAACTTTAACTCCTGGAGCCAGG + Intronic
1130970111 15:88725700-88725722 AAACTTTACCTCCTGGTGATAGG + Intergenic
1132003309 15:98202097-98202119 CAACTGAAGCACCTGGGGGTGGG - Intergenic
1133331348 16:4976607-4976629 CACAATTAGCATCTGGAGATGGG - Intronic
1133705555 16:8351459-8351481 CCACTTTATAACCTGCAGATGGG + Intergenic
1135067267 16:19320907-19320929 CAACATTAGCACTTGGACTTTGG + Intronic
1146060181 17:29600833-29600855 CAACTTTAGAACATGGAAAGTGG - Intronic
1148852960 17:50563581-50563603 CTCCACTAGCACCTGGAGATAGG - Intronic
1149278451 17:55072442-55072464 TAACTTTAGCCCCTGGAGCTTGG + Intronic
1150719248 17:67600202-67600224 CAACTGTAAAACCTAGAGATTGG + Intronic
1151276109 17:73035547-73035569 TAAATTAAGGACCTGGAGATGGG + Intronic
1154336909 18:13473281-13473303 CAACTAGAGAAGCTGGAGATGGG - Intronic
1155902534 18:31409048-31409070 CAGCTATAGGACCTGGAGATAGG - Intronic
1160087159 18:75787111-75787133 GAAGTTAAGGACCTGGAGATGGG - Intergenic
1161585797 19:5104839-5104861 CAACTTTGGGACCTGGAGTCAGG - Intronic
1167419539 19:49394922-49394944 CCACTTTTTCACCTGGAAATGGG - Intronic
926594857 2:14779134-14779156 CATCTTCAGCTCCTGGATATTGG - Intergenic
936327834 2:111520912-111520934 CAACTTTAGAATCTGGATATTGG + Intergenic
936491979 2:112979728-112979750 CTGCTTGAGCACATGGAGATGGG - Intronic
937900380 2:127015456-127015478 AAACGTGAGCACCTGTAGATGGG - Intergenic
940341265 2:152584005-152584027 CACCTTTTGCACCTCAAGATTGG - Intronic
941757869 2:169207466-169207488 CTACTTTAGAAGCTGAAGATAGG - Intronic
944427562 2:199599205-199599227 CAACTTTAGCACATAGAAATAGG - Intergenic
948219265 2:236256392-236256414 CAACCTCTGCACCTGGATATTGG - Intronic
1171306163 20:24108462-24108484 CAATTTTTGCACCTGGAAATTGG - Intergenic
1174658420 20:52191168-52191190 CAAAATTAGAGCCTGGAGATTGG - Intronic
1175540725 20:59746091-59746113 CAATTCTGGCACCTGGAAATTGG + Intronic
1177830609 21:26134694-26134716 AAACTTCAGCTCCTGGAGGTTGG + Intronic
1179346688 21:40564921-40564943 CAAGGTGAGCACCTGGAGATTGG + Intronic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
958477503 3:94603626-94603648 CCACTTATGCACTTGGAGATTGG + Intergenic
958564052 3:95783819-95783841 CAACTTTAGACTCTGGAGTTTGG - Intergenic
969218596 4:5744244-5744266 CAGCTTTCTCACCTGGAAATGGG + Intronic
969504579 4:7576892-7576914 CAATTTTACCATCTGGAAATGGG + Intronic
972123493 4:35735337-35735359 CAAGTGGAGCACCTGCAGATAGG - Intergenic
974542225 4:63251790-63251812 CAACAGTAGCAGCTGGAAATAGG - Intergenic
977277157 4:94992040-94992062 CAACTTTGGAACATGGAGCTGGG - Intronic
980082299 4:128357043-128357065 CATCTTAAGAACCTTGAGATAGG + Intergenic
981685275 4:147447433-147447455 CAAATGTAGAACCTGCAGATAGG + Intergenic
983469994 4:168144152-168144174 CAATCTTGGCACCTGGAGAGAGG - Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991507946 5:67344013-67344035 CAACTTGGGCACCAGGAGAGGGG - Intergenic
993201095 5:84816090-84816112 CAACTTTATCACCTGTAAAATGG - Intergenic
993618684 5:90142972-90142994 CATCTTTAGCTCCTGGACCTTGG - Intergenic
994130579 5:96223063-96223085 CAACTTAACCTCATGGAGATAGG + Intergenic
1000127936 5:158265620-158265642 CAGCATTATCACCTGGAGGTGGG - Intergenic
1001207527 5:169778252-169778274 CAGCTTTAGCACCTGCAAAGAGG - Intronic
1001303876 5:170557332-170557354 CAACTTTCTCTCCTGAAGATGGG + Intronic
1004992989 6:21160162-21160184 AAACTTTCAAACCTGGAGATAGG - Intronic
1007802751 6:44411389-44411411 CAACTTTATACCCTGTAGATAGG - Intronic
1008411578 6:51186609-51186631 CATATTTAACAACTGGAGATTGG + Intergenic
1012411625 6:98964990-98965012 CCACTTTAGCAACTGCAGATTGG + Intergenic
1014505960 6:122256575-122256597 CAATTTTAGTATCTGAAGATAGG + Intergenic
1021119238 7:16779285-16779307 CAACTTTAGGACCGGGTGAAAGG + Intronic
1024089476 7:45923252-45923274 CAGCTTTATCATCTGGAGAGTGG + Intergenic
1028438745 7:90834612-90834634 TAAGTTTATAACCTGGAGATGGG + Intronic
1028988598 7:97026492-97026514 AAACTTCAGCACCGGGAGACTGG + Intergenic
1031030869 7:116733457-116733479 CAACTTTAGAATGTGGAAATAGG - Intronic
1031453349 7:121949503-121949525 AAAGTTTAGCACCTAGAGTTGGG - Intronic
1034846923 7:154454888-154454910 AAACTTTAACACCTGGACCTTGG - Intronic
1034940935 7:155229788-155229810 CAACGTTCCCACCTGGAGAGTGG + Intergenic
1035581341 8:741469-741491 TAACTTTAGCTCCAGGAGAGGGG + Intergenic
1036194033 8:6698564-6698586 CCCCTTCAGCACCTGGTGATTGG - Intergenic
1039678842 8:39706005-39706027 CATCTTTAGCAGTTGGAAATGGG + Intronic
1042875485 8:73437240-73437262 CAGGTTAAGTACCTGGAGATGGG + Intronic
1048224057 8:132567811-132567833 CATATTTGGCATCTGGAGATGGG - Intergenic
1050457550 9:5848185-5848207 TAACTTAAGGACCTTGAGATGGG + Intergenic
1055599767 9:77903549-77903571 CACCTTTAGCCCCTGGGGAAAGG - Intronic
1057357527 9:94344212-94344234 CAACTTAAATACCTGGATATAGG + Intergenic
1057650227 9:96913414-96913436 CAACTTAAATACCTGGATATAGG - Intronic
1062145641 9:134988309-134988331 CAACTTTTCCACGTGGAAATTGG + Intergenic
1186918754 X:14253391-14253413 AAAATTAAGGACCTGGAGATGGG + Intergenic
1188866007 X:35313654-35313676 TAAATTTAGAACCTTGAGATTGG - Intergenic
1189523035 X:41790236-41790258 CAACTTTAGCACCTGGAGATGGG + Intronic
1191791395 X:64975934-64975956 CAACTTCAGAACCTGGAGTTCGG - Intronic
1191873238 X:65768299-65768321 CAACTTTAGAACTGGGCGATGGG + Intergenic
1192344404 X:70289465-70289487 CAACCTTAACACCTAGATATGGG - Intronic
1199443434 X:147895150-147895172 CAACATTAGCATTTGGAGCTGGG - Intergenic