ID: 1189526061

View in Genome Browser
Species Human (GRCh38)
Location X:41823251-41823273
Sequence CTTTTGGTCTTGATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189526056_1189526061 3 Left 1189526056 X:41823225-41823247 CCTAGCTCTATCAGTACCTTGAC 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 229
1189526054_1189526061 15 Left 1189526054 X:41823213-41823235 CCTGCCTGCAGGCCTAGCTCTAT 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 229
1189526055_1189526061 11 Left 1189526055 X:41823217-41823239 CCTGCAGGCCTAGCTCTATCAGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 229
1189526051_1189526061 30 Left 1189526051 X:41823198-41823220 CCTCTGGTTCCTTCTCCTGCCTG 0: 1
1: 1
2: 58
3: 2971
4: 6533
Right 1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 229
1189526053_1189526061 21 Left 1189526053 X:41823207-41823229 CCTTCTCCTGCCTGCAGGCCTAG 0: 1
1: 0
2: 6
3: 74
4: 1016
Right 1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189526061 Original CRISPR CTTTTGGTCTTGATGGAAGA GGG Intronic
903187604 1:21637734-21637756 TCTTTAGTCTTGATGGAAAAGGG + Intronic
903366491 1:22808473-22808495 CTTCTGGACTGGGTGGAAGAGGG - Intronic
905046113 1:35003860-35003882 CTTTTCTTTTTGCTGGAAGAGGG - Intronic
906417144 1:45629249-45629271 CTCTTGGTCTTTAAGGAAGCAGG - Intronic
906417508 1:45632159-45632181 CTCTTGGTCTTCAAGGAAGCAGG + Intronic
907669342 1:56461221-56461243 CTTATGGTCTTAAAGGAAAAGGG - Intergenic
907761508 1:57366135-57366157 GTTTTGGTCTTGAAGGAGGAAGG - Intronic
907868782 1:58424158-58424180 CTTTTGGACTTGAACGAAAATGG - Intronic
909013612 1:70360403-70360425 CTTGTGTTCTTGAAGGAAGCAGG - Intronic
915365112 1:155310696-155310718 CTTTTGGCTCTGATGGAAGGTGG + Intronic
915577762 1:156791968-156791990 GTTTTTTTCTTCATGGAAGAAGG + Intronic
916979424 1:170116924-170116946 TGTATGGTCTTGATGGAAGAAGG + Intergenic
917026350 1:170646756-170646778 CCTTTGGCCCTGATGGATGAGGG + Intergenic
918232590 1:182549680-182549702 CTTTTTTTTTTGGTGGAAGATGG - Intronic
918370880 1:183860262-183860284 CTTTTATTCTTGGTAGAAGAGGG + Intronic
918539057 1:185607348-185607370 ATTTTTGTCGTGATGCAAGAAGG + Intergenic
918643636 1:186876049-186876071 CTTATGGCCTTGAGGAAAGAAGG + Intronic
919837259 1:201583370-201583392 CTTTTTGTCTTAATTGCAGATGG - Intergenic
921634070 1:217471635-217471657 CTTTCTAACTTGATGGAAGAGGG + Intronic
922195577 1:223357121-223357143 CTTTTGTGCCTGTTGGAAGAAGG - Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
924838453 1:247679953-247679975 CTTTTGGTCTTCACAGAAAAAGG - Intergenic
1063440940 10:6072475-6072497 CTGTGGGTCTTTATGGATGAGGG - Intergenic
1063902232 10:10745937-10745959 CATTTGGTTTTGATGGCATAGGG + Intergenic
1064822707 10:19356346-19356368 CTTTTGATGTTTATGGAAGTTGG + Intronic
1065370256 10:24977002-24977024 TTTTTATTCTGGATGGAAGAGGG - Intergenic
1065493079 10:26302330-26302352 CTTTGGATCTCGATGGGAGATGG - Exonic
1066439937 10:35428701-35428723 GTTGTGGTCTAGGTGGAAGATGG + Intronic
1066504092 10:36023988-36024010 CTTTTTCTCTGGCTGGAAGAAGG + Intergenic
1068313111 10:55305067-55305089 TTTTTGTTCTGGATGGAATATGG - Intronic
1071874750 10:89833091-89833113 CTTTTGGTCTCCCTGGTAGAAGG + Intergenic
1073186789 10:101619818-101619840 CTAGTGGTCTTGATGGAATGAGG + Intronic
1074549116 10:114426887-114426909 CATTTGGACTTGATGGGAGGGGG + Intergenic
1075122194 10:119672415-119672437 CTTCTGGGCTTGGTGGAAGGAGG - Exonic
1075306839 10:121375541-121375563 CTTTTGGTCTGGAGAGGAGATGG - Intergenic
1075886399 10:125903157-125903179 CTTTACTTCTTGATGGGAGAAGG + Intronic
1076639805 10:131907204-131907226 TTTTTGGTCTTAATGGGACATGG + Intronic
1077838054 11:5942069-5942091 CTTTTGGTCCTACGGGAAGAGGG + Intergenic
1077915824 11:6611003-6611025 CTTGCGGTCCTGAGGGAAGAGGG + Exonic
1078621337 11:12911401-12911423 CTGTTGCTATTCATGGAAGAGGG + Intronic
1079083153 11:17428017-17428039 CTTTTGGCTTTCATGGAGGAGGG - Intronic
1081117896 11:39228033-39228055 CTTTTGGAGGTCATGGAAGATGG - Intergenic
1082787635 11:57325499-57325521 CTTTTGTTCTTACGGGAAGAAGG - Intergenic
1082851734 11:57771158-57771180 CTTTTTGTATTCATTGAAGAAGG + Intronic
1083848673 11:65352492-65352514 CTTTTGGTTTTGTGGGGAGAGGG + Exonic
1084272654 11:68037429-68037451 CTTTTGGAAATGATGGTAGATGG - Intergenic
1085087768 11:73682982-73683004 CTTTATGTCTTGATGAAAGGTGG - Intronic
1086853365 11:91837918-91837940 CTTTTGCTCTGGATGTTAGAGGG - Intergenic
1087021248 11:93605588-93605610 TTTTTGGTATTCATGGAAGGGGG + Intergenic
1088164352 11:106914863-106914885 CTTTTTTTCTTGTTGGAAGATGG - Intronic
1089665529 11:120015831-120015853 CTTTTGCTCTTGGAGGAGGAGGG - Intergenic
1089849231 11:121482129-121482151 GTTTTGGACTTGAAGGAGGAGGG + Intronic
1089883128 11:121794296-121794318 CGTTATGTTTTGATGGAAGACGG + Intergenic
1090903565 11:131053717-131053739 CTCTTGGTATTGAGGGAAGGTGG - Intergenic
1091949490 12:4581075-4581097 CTTTGGGTCTTGGTGTGAGAGGG + Intronic
1092442176 12:8515223-8515245 CTTTTGGTCCTAGTGGAAGGAGG + Exonic
1096795739 12:54076477-54076499 CTTTAAGCCTTGATGGGAGAGGG + Intergenic
1098028379 12:66230030-66230052 TTTTGGCTCTTGATGGGAGATGG + Intronic
1098350778 12:69557505-69557527 CTTTTGGTGTTGCTAGAGGATGG + Intronic
1098488345 12:71047284-71047306 CCTTTGATCTTGATGGCAGAGGG - Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1102622060 12:114203933-114203955 CTTTTGCTCATGGTGGAAGATGG - Intergenic
1103017936 12:117510168-117510190 CTTTTGGTATTGATGGAACTAGG - Intronic
1104070872 12:125344407-125344429 CTTTTGGGCTAGAGGGAAAAGGG + Intronic
1105585883 13:21742421-21742443 ATTTTGGACTTTATGGAAGAGGG - Intergenic
1106505528 13:30367930-30367952 CTTTAAGTCCTGATGGAAAATGG + Intergenic
1106894034 13:34278425-34278447 CTTTTGGACATAGTGGAAGAGGG + Intergenic
1108592749 13:51925341-51925363 CTTTTGCTGATGATGTAAGATGG - Intergenic
1109324232 13:60848550-60848572 CTTTTAGCCTTTGTGGAAGAAGG + Intergenic
1111584654 13:90268631-90268653 CTTGTGGTATTGATGCAGGAGGG - Intergenic
1111651203 13:91092977-91092999 TTTTTGTTCTTGAGGGCAGAGGG - Intergenic
1111726224 13:92013113-92013135 CCTTTGCTCTTGCTGGCAGAGGG - Intronic
1113151061 13:107263949-107263971 CTTTTGGTTGTGTTGGAACATGG + Intronic
1115221640 14:31063996-31064018 CTGGTGGTCATGATGAAAGAAGG + Intronic
1116973347 14:51091952-51091974 CTTTTGGTCTTAATAGATCAAGG + Intronic
1118827634 14:69398428-69398450 CTTTTTGCCTTTATCGAAGATGG - Exonic
1120766066 14:88327164-88327186 CTTCTGGACTTCAGGGAAGAAGG - Intergenic
1120868445 14:89316182-89316204 CTTTTTCACTTGATGGCAGAAGG - Intronic
1124176637 15:27431584-27431606 CATTTTGTCTTGTTGGAAGGGGG + Intronic
1124183115 15:27496886-27496908 CTTTTGGTCTTGATATATCAGGG + Intronic
1125238971 15:37550738-37550760 CCTGTGGTCTTGAAGGAGGATGG - Intergenic
1125419431 15:39489423-39489445 CTGTTGTCCATGATGGAAGAAGG + Intergenic
1128005769 15:64238969-64238991 TTTTTGGTAGTGATGGCAGAAGG - Intronic
1128904064 15:71451820-71451842 GTTTTGGTCCTGAGGAAAGAGGG + Intronic
1130880129 15:88047799-88047821 CCTTTGGTCTGGATGAAAAATGG + Intronic
1132459387 16:43114-43136 CCTGTGGTCTCTATGGAAGAAGG + Intergenic
1133149153 16:3813914-3813936 CATTTGGTGTGGAAGGAAGATGG - Intronic
1133211252 16:4264454-4264476 CTTTGGGTCCTGATGGAGGAGGG - Intronic
1133674427 16:8057222-8057244 CTTTTGGTGTTTTAGGAAGAGGG - Intergenic
1133895920 16:9928761-9928783 CTTTGGGTCTCGACGGATGAGGG - Intronic
1134410612 16:14000590-14000612 CTTTTACTCCTGATTGAAGATGG - Intergenic
1137384315 16:48027543-48027565 CTATTGGTCTTGTTGGAATCAGG - Intergenic
1137767937 16:50992132-50992154 CTTTTGCTATTGGTGGGAGATGG + Intergenic
1138724265 16:59118815-59118837 CCTTTGGTCTTCTTGGCAGATGG + Intergenic
1139279748 16:65760119-65760141 GTTTAGATCGTGATGGAAGAGGG + Intergenic
1140250333 16:73289378-73289400 CTTTTGGTGGGGATGTAAGAGGG + Intergenic
1140685795 16:77433396-77433418 ATTCGGTTCTTGATGGAAGAAGG + Intronic
1145113001 17:20181587-20181609 GTTTTGGTATTGATGCAATAAGG + Intronic
1147044313 17:37742424-37742446 CTTTTCGTCTTAAGGGAACACGG + Intronic
1147303810 17:39549745-39549767 CTTTTGGGCTTTGTGGATGAAGG - Intronic
1150740501 17:67775640-67775662 GTTCAGGTCATGATGGAAGAGGG - Intergenic
1151074036 17:71250494-71250516 ATTCTGGTCATGAAGGAAGATGG + Intergenic
1158024264 18:52877346-52877368 CTATTGGTCTAGAGGGAGGAGGG + Intronic
1158466513 18:57695077-57695099 CTTTTGGTTTTGATGGACAAAGG + Intronic
1158978380 18:62734312-62734334 CTCTGGATCTTCATGGAAGAAGG + Intronic
1162326047 19:10000289-10000311 ATTTTGGTCTTGGAGAAAGATGG - Intronic
1163429204 19:17256882-17256904 CATGTGGTCTTGATGGAAGGTGG - Intronic
1164006251 19:21152188-21152210 CTTTTGGTCTCTAGGCAAGATGG + Intronic
1164697247 19:30254760-30254782 TACTTGGTCTTGATAGAAGATGG + Intronic
1165765475 19:38347969-38347991 CTTTTGACCTTGATGGGAGGAGG - Intronic
1168277344 19:55285086-55285108 CTTTTGGGTTTGAGGGAGGAGGG + Intronic
925226760 2:2190154-2190176 CTTTTCCTCTTATTGGAAGAAGG + Intronic
926150219 2:10421693-10421715 CTTTTGGTCTTTTTGGAGGCAGG - Intronic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
926466435 2:13195055-13195077 CTTTTACTCTTGATGTGAGATGG + Intergenic
926647069 2:15301645-15301667 CTTTTCATCTTACTGGAAGAAGG - Intronic
926844911 2:17125677-17125699 CTTTAGGTATAGCTGGAAGAAGG - Intergenic
927107465 2:19840423-19840445 CTTATGGGCTTGCTGGTAGAAGG - Intergenic
929746352 2:44663398-44663420 GTTTTGGTTTTGCTTGAAGATGG - Intronic
930201148 2:48553199-48553221 GTCTTCCTCTTGATGGAAGAGGG + Intronic
931193666 2:60029261-60029283 CTCTTGTTTTTGATGGCAGAAGG - Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932182646 2:69662472-69662494 CTCATGGCCTTGATGAAAGATGG - Intronic
932190543 2:69738471-69738493 CTCATGGCCTTGATGAAAGATGG + Intronic
932276527 2:70455972-70455994 CTTCTGGTGCTGATGGAAGGAGG + Intronic
932511455 2:72297076-72297098 CTTTTCATCTTGAAGGAATAGGG - Intronic
936156055 2:110048157-110048179 CTTTTGACCTTGATGGAGGGTGG - Intergenic
936188633 2:110323271-110323293 CTTTTGACCTTGATGGAGGGTGG + Intergenic
936628198 2:114171459-114171481 CTTTTTGTATTCATGGCAGATGG + Intergenic
938616760 2:133007332-133007354 CTTTTGGTGCTGATGTGAGAAGG + Intronic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
943435344 2:187858907-187858929 CTTTTTGGTTTCATGGAAGAAGG + Intergenic
944271848 2:197793031-197793053 CTTCTGTTGTTTATGGAAGAGGG - Intergenic
946060710 2:216938977-216938999 GATTTGATCTTGATGGTAGATGG - Intergenic
948016992 2:234699194-234699216 CTTTTGGGGTTGGGGGAAGAAGG + Intergenic
1169558974 20:6778695-6778717 CTTTTGGCCATGATGGAAAAGGG + Exonic
1170085916 20:12531385-12531407 GTTTTGAACTTGAGGGAAGAAGG + Intergenic
1170434918 20:16316481-16316503 CTTTTTTTCTTTTTGGAAGATGG - Intronic
1172506679 20:35467793-35467815 ACTTTGGTGTTGATGGAGGATGG - Intronic
1173830485 20:46082551-46082573 CTTTTGGTCTTAAGGGCAGTTGG - Intronic
1177921358 21:27156500-27156522 CTTTTCGTCATGATGGAGGGAGG - Intergenic
1180286406 22:10748670-10748692 CTTTACTTCTTGATGGGAGAAGG + Intergenic
1180410088 22:12598665-12598687 CTTTTCCTCATGATGGAAGGTGG - Intergenic
1181964776 22:26648566-26648588 TTTTTTGTCTTAATGGAAAATGG + Intergenic
1182742171 22:32575856-32575878 TTTTTTGTCTTGAGGAAAGAAGG - Intronic
1185033162 22:48456200-48456222 CATATTGTCTTGATGGAAGGAGG - Intergenic
953232998 3:41081064-41081086 GTGTTGGTCTGTATGGAAGATGG + Intergenic
955114736 3:55986474-55986496 CTTTTGGTTTTCAAGGATGAAGG - Intronic
956236462 3:67077737-67077759 TACTTGGACTTGATGGAAGAAGG - Intergenic
956244382 3:67165372-67165394 CCATTGGACTTGGTGGAAGAAGG + Intergenic
957440480 3:80240410-80240432 CTTTTGAACATGATGGTAGAGGG + Intergenic
957742674 3:84292347-84292369 CTTTTGGCATGGATGGAATATGG - Intergenic
959468732 3:106721909-106721931 CTTTTGATCTTGATAGCAGCAGG - Intergenic
960804402 3:121569137-121569159 CTTTAGGGCTTAATGGAAGATGG + Intergenic
961248687 3:125480718-125480740 TTTTTGGTCCTTATGGAAAATGG - Intronic
961559808 3:127720845-127720867 CTTTTTGTCTTGGGGGAAAATGG + Intronic
962984011 3:140518105-140518127 CTTTTGGGCTACATGGAAGCTGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964846902 3:161054189-161054211 CCTCAGGTCTTGATGGAAGAAGG + Intronic
966160339 3:176961060-176961082 TCTTTGGGGTTGATGGAAGAAGG - Intergenic
966586824 3:181635488-181635510 CTTTTGGTCTTGTGGGAAGTAGG - Intergenic
966758376 3:183392739-183392761 CTTGTGGTCCTGTTGGAATAGGG + Intronic
966880462 3:184347042-184347064 CGATTGGACTTGATGGACGAGGG + Intronic
967096978 3:186185419-186185441 ACTTTGGTCTTGCTTGAAGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969968620 4:11022819-11022841 TTTCTGGTCTTGAGGGAAGGAGG + Intergenic
970345381 4:15147801-15147823 CTTTTGTGCCAGATGGAAGAAGG - Intergenic
972183382 4:36497269-36497291 CTATGGGTCTTGGTGGAAGCGGG - Intergenic
973842584 4:54877111-54877133 CATTTGAACTTGATGGAAGATGG - Intergenic
974529850 4:63093599-63093621 ATTCTGGTCTAGATGGAATATGG + Intergenic
977344557 4:95800869-95800891 TTATGGGTCTTGATGAAAGAAGG - Intergenic
980311241 4:131132282-131132304 CTTTTGGTTTTGAAGGTAAAGGG + Intergenic
981738340 4:147976163-147976185 CTCTTGCACTTGATGGAAAATGG - Intronic
982266272 4:153541356-153541378 CTTTTGGTCCTCATGGAATGTGG + Intronic
984160665 4:176248852-176248874 CACTCGGTCTTGATGGGAGAAGG + Intronic
984919688 4:184752491-184752513 CTTTTGTTCTTGATGGATTTGGG + Intergenic
985980549 5:3458810-3458832 CTTTTGCTCTTGACAGAAGAGGG - Intergenic
986795111 5:11202649-11202671 CTTCTGGTCCTGATGGGAGAGGG - Intronic
991622968 5:68565514-68565536 CTTTTGGGCTGCATGGGAGACGG + Intergenic
992367547 5:76108613-76108635 TTTTTGGCCTCGATGGAATACGG - Intronic
995594349 5:113731769-113731791 GCTCTGGTCATGATGGAAGAGGG - Intergenic
995609804 5:113897519-113897541 TATATGGTTTTGATGGAAGAGGG + Intergenic
995864222 5:116674051-116674073 ATTTTGGTATTGATAGAATATGG + Intergenic
996597309 5:125220184-125220206 CTTTTGTGCTTGATGAAAGAAGG - Intergenic
996665981 5:126060938-126060960 TGTTTGCTTTTGATGGAAGATGG + Intergenic
996823450 5:127655344-127655366 CATTTGGGCTGGATGGAAAAAGG + Intronic
998437163 5:142120859-142120881 TCTTTGTTCTTGAAGGAAGAGGG + Intronic
1000903206 5:166933407-166933429 GTTCAGGTCATGATGGAAGAGGG - Intergenic
1001672780 5:173488049-173488071 CTTTAGGTTCTGATGGATGAGGG - Intergenic
1002356146 5:178630586-178630608 CCTTTGATCTTGCTGAAAGATGG - Intronic
1003379663 6:5611936-5611958 CTTTTGTTCCTTATGGAAAATGG - Intronic
1006082713 6:31576669-31576691 GTTTTGGTCTTGGGGGAGGATGG + Intronic
1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG + Intergenic
1008626790 6:53325015-53325037 GTTTCGGTCTAGATGGAACAGGG - Intronic
1008810529 6:55492365-55492387 TTTTTGTTGTTGTTGGAAGAGGG + Intronic
1009278144 6:61711940-61711962 CTTTTGGTTTCGCTGGAAGTTGG + Intronic
1010886894 6:81254942-81254964 CTAGTGGTCTTTCTGGAAGAAGG + Intergenic
1012589612 6:100964798-100964820 CTTTTGATCCTGATGTAGGAAGG - Intergenic
1014080114 6:117276095-117276117 ATTTGGGTCTGGATGGGAGATGG + Intergenic
1014337404 6:120154547-120154569 CATTTGGGATTGATGGTAGATGG - Intergenic
1015614847 6:135063985-135064007 ATTCTGGCCGTGATGGAAGAGGG + Intronic
1016382327 6:143497660-143497682 CTTTTGGTCTTGGGGGAGGAAGG - Intronic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1018223925 6:161609669-161609691 GTTTTGGTTTTGGTGGAATAGGG - Intronic
1019108080 6:169685107-169685129 CTTTTGGTCTTGATTCTAGGTGG - Intronic
1020408359 7:7863669-7863691 CATTGGCTCTTGATGCAAGAAGG - Intronic
1020564535 7:9778712-9778734 CCTTTGCCCTTGATGGCAGAGGG - Intergenic
1021481035 7:21117329-21117351 CTTTTTGTCTTTAGGGGAGAAGG - Intergenic
1021623307 7:22568883-22568905 TTTTTGTTTTTGATAGAAGAGGG + Intronic
1023531459 7:41160399-41160421 CTTATGTTCTTGCTGGAAAAGGG - Intergenic
1024483554 7:49890632-49890654 CTTTTAGCCATGATGGAACAGGG + Intronic
1031760561 7:125708204-125708226 CTATTGTTCTTTATGGAACAGGG - Intergenic
1033741855 7:144282290-144282312 CTTTTGGTCTTCATGGGTCATGG + Intergenic
1033752046 7:144367324-144367346 CTTTTGGTCTTCATGGGTCATGG - Exonic
1035819111 8:2572441-2572463 CTTTTGGTCCTCATGGGATAAGG - Intergenic
1036940956 8:13051300-13051322 CTAGTGGTCATGATGGAAGAGGG + Intergenic
1038124893 8:24662532-24662554 CTTTTGGTCCTGAGGAAAGTGGG - Intergenic
1039203406 8:35122177-35122199 CTTTGTGTCTTTCTGGAAGAGGG + Intergenic
1039271647 8:35887828-35887850 CTTTTGGTGTTAAGGGAAAAAGG + Intergenic
1039484198 8:37898857-37898879 CTTTGGGTCTTCTTGGAAGAAGG - Intronic
1040683503 8:49842388-49842410 CTTTTGCCCTTGCTGGCAGAAGG + Intergenic
1041465049 8:58150077-58150099 CTTTTGGTTCCAATGGAAGATGG + Intronic
1042817745 8:72896206-72896228 CTTGTGGACTTTCTGGAAGAGGG - Intronic
1045888389 8:107126418-107126440 CTTATGATCATGATGGAAGGGGG + Intergenic
1046272433 8:111914529-111914551 CCTATGGACTTGATGGGAGAAGG - Intergenic
1046302075 8:112307879-112307901 TTTTTGGTCGAAATGGAAGATGG - Intronic
1046735643 8:117773832-117773854 CTTTTGGTTTTTATTGAAGAAGG - Intergenic
1047189199 8:122662454-122662476 CTTTTGTTTTTGATGGAGCAAGG - Intergenic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047208841 8:122824526-122824548 CTTTGTATTTTGATGGAAGAGGG - Intronic
1047848643 8:128831764-128831786 TTTTTGAACTTGAAGGAAGAAGG - Intergenic
1050636478 9:7618206-7618228 GTTTAGGCCATGATGGAAGAGGG + Intergenic
1051761868 9:20476261-20476283 CTTTGAGTCTTGTAGGAAGATGG - Intronic
1052660196 9:31419495-31419517 CTTTTGCCCTTGCTGGCAGATGG + Intergenic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053785365 9:41649153-41649175 CTTTAAGCCTTGATGGGAGACGG + Intergenic
1054159665 9:61665020-61665042 CTTTAAGCCTTGATGGGAGACGG - Intergenic
1054448947 9:65392172-65392194 CTTTAAGCCTTGATGGGAGACGG + Intergenic
1054702725 9:68429953-68429975 GTTTTTGTGTTGCTGGAAGAAGG + Intronic
1055187148 9:73470845-73470867 CTTTTGGGCTGCATGGTAGACGG - Intergenic
1056974492 9:91238924-91238946 CTTTTGGTCTTGGAGGAAAGGGG - Intronic
1057334575 9:94145900-94145922 TTTCTGGCCTTGATGGAAGATGG + Intergenic
1059754827 9:117282706-117282728 CATTTGGTTTTCATGGCAGAGGG - Intronic
1059800028 9:117740987-117741009 CTTTTGGTGTTGATTAAATAAGG - Intergenic
1061659273 9:132117690-132117712 TTTTTTTTCTTCATGGAAGATGG - Intergenic
1203732765 Un_GL000216v2:105835-105857 CTTTACTTCTTGATGGGAGAAGG + Intergenic
1188427189 X:30062558-30062580 CTTTTTGTCTCAATGCAAGAAGG - Intergenic
1188844259 X:35053915-35053937 CCTTTGTTCCTGATGGAAGAGGG + Intergenic
1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG + Intronic
1193720486 X:84979805-84979827 CATTTGGTCTTTGAGGAAGAAGG + Intergenic
1194791522 X:98156896-98156918 CTTTTAGTATTGTTTGAAGATGG - Intergenic
1194998321 X:100616173-100616195 CTTCTTGCCTTCATGGAAGACGG + Intergenic
1195488057 X:105432922-105432944 TTTTTTGTCTTGGTGGCAGATGG + Intronic
1199537746 X:148922516-148922538 CATTTGGTCTTCATGGAATATGG + Intronic
1201514758 Y:14807994-14808016 CTTCTGATCTTCATGGAAGCAGG + Intronic