ID: 1189529577

View in Genome Browser
Species Human (GRCh38)
Location X:41865888-41865910
Sequence CTGGGAAACCTTGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189529564_1189529577 22 Left 1189529564 X:41865843-41865865 CCATCTGCAGGGATAAAAGGTAC 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 306
1189529568_1189529577 -4 Left 1189529568 X:41865869-41865891 CCAGGGCCACTTGCTATTGCTGG 0: 1
1: 0
2: 3
3: 19
4: 173
Right 1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 306
1189529571_1189529577 -10 Left 1189529571 X:41865875-41865897 CCACTTGCTATTGCTGGGAAACC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 306
1189529567_1189529577 -3 Left 1189529567 X:41865868-41865890 CCCAGGGCCACTTGCTATTGCTG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189529577 Original CRISPR CTGGGAAACCTTGAGGGGGA GGG Intronic
900297451 1:1959052-1959074 CTGGGAACCCCAGTGGGGGACGG - Intronic
901104399 1:6743993-6744015 CTGGCAAACATTAAGGAGGAAGG - Intergenic
902157845 1:14503994-14504016 CTGTGCAACCTTGAGAGTGAGGG - Intergenic
902879244 1:19360051-19360073 CTGGAACACCTGGAGAGGGATGG + Intronic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
904803382 1:33113445-33113467 CTGGAAAATCTTAAGGGGGTGGG - Intronic
905431881 1:37930767-37930789 CTTGGAAACTATGAGGGGCAGGG - Intronic
905523823 1:38621734-38621756 CAGGGACACCTAGAGGGGGGTGG - Intergenic
907123039 1:52024467-52024489 CTGGGAATCCATGATGTGGATGG - Intronic
912210972 1:107556633-107556655 CTGGGAAGCCTTGGCAGGGATGG + Intergenic
912452053 1:109773284-109773306 CTGGGAGACCATGGGGAGGACGG + Intronic
912489518 1:110054204-110054226 CTGGGAAAGCTGGAATGGGATGG + Exonic
912650045 1:111429883-111429905 ATGTGAAATCTTGAGGGGCAGGG - Intergenic
915445174 1:155970493-155970515 CTGGGAAACCTTGGAGGGAGTGG - Intronic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
917503088 1:175603758-175603780 CTGGGAGGCCTGGAGGGGGCAGG + Intronic
918701305 1:187611826-187611848 CTGGGAAAGGTAGTGGGGGATGG + Intergenic
919854150 1:201694282-201694304 CTGGGAAACCTTGAGGGCAAAGG + Intronic
919888064 1:201949524-201949546 CTGGGCAACACTGAGGGTGAAGG - Intergenic
920045643 1:203130479-203130501 CTGGAAAACCTGGAGGGTGGAGG - Intronic
920661596 1:207920239-207920261 CTGTGAAACATTGAGTAGGAAGG + Intergenic
921964318 1:221071716-221071738 CTGGGAGACTATGAGGGTGAAGG + Intergenic
923503090 1:234582645-234582667 CTGGGAAACCTAGAGGGCCAAGG + Intergenic
1063607749 10:7537669-7537691 CTGGGAAACCTTGGATGGAAGGG + Intergenic
1064205378 10:13319593-13319615 CTGGGAAAGCTGAAGTGGGAGGG - Intronic
1064861511 10:19831393-19831415 GTGGGAAACCATGAAAGGGAAGG + Intronic
1066236775 10:33492557-33492579 CTGGGCAACCTTGAGATGGAAGG - Intergenic
1067294962 10:44970323-44970345 CTGGGCAGCCTTTAGGTGGAGGG + Intronic
1067297397 10:44982623-44982645 CTGGGCATCCATGAGGTGGAGGG - Exonic
1067427311 10:46219996-46220018 CTGGGACTCCATGAAGGGGAGGG - Intergenic
1068293758 10:55039670-55039692 TTGAGAAAACTTGAGGGAGATGG + Intronic
1068742027 10:60484205-60484227 CTGAAAATCATTGAGGGGGATGG + Intronic
1069766898 10:70868849-70868871 CTGGGAAAACTTTAGTGTGAGGG + Intronic
1069834170 10:71298125-71298147 CTGTGAGACCTTGAGGACGAAGG - Intronic
1070567243 10:77613251-77613273 CTGGGGAAGGTTGTGGGGGAAGG - Intronic
1070646287 10:78204437-78204459 CTGGGATTTCTGGAGGGGGAAGG + Intergenic
1073067722 10:100773519-100773541 CTTGGAAACCCTGAGGCGGACGG + Intronic
1074154929 10:110789758-110789780 CTGGGGACCCTAGAGTGGGATGG - Intronic
1074242338 10:111651683-111651705 CTTGGAAACCTAGAGTGGGTAGG + Intergenic
1074455970 10:113595317-113595339 CTGGGTAACCATGAGGGGAGTGG - Intronic
1074693797 10:116029850-116029872 CTGGGAAGCCCTGAGGAGCAGGG - Intergenic
1075568276 10:123520375-123520397 CTGGGAAAGCATCATGGGGAGGG - Intergenic
1075700743 10:124468055-124468077 CTTGGAATCCTTCAGGGAGAAGG + Intronic
1076986205 11:237301-237323 CTGAGGAACCTTGAGTGGCAGGG + Intronic
1077258249 11:1599230-1599252 CTGGCAAAGCTTGAGAGAGAAGG + Intergenic
1077267622 11:1659892-1659914 CTGGGAAGCCGTGAGGCTGAGGG + Intergenic
1077328916 11:1975457-1975479 CTGGGAAACCCTGAGCCAGAGGG + Intronic
1078498121 11:11841395-11841417 CTGGGGGCCCTTGAGAGGGAGGG + Intergenic
1079103803 11:17558031-17558053 TTGGGAAACCCTGATTGGGATGG + Intronic
1081371402 11:42308801-42308823 AGGGGAAACCTTGAGAGAGAAGG - Intergenic
1082180130 11:49106965-49106987 CTGGGAAGCGGTAAGGGGGATGG - Intergenic
1082869673 11:57932414-57932436 CTGGGAACCCCTGAGGAGCAGGG + Intergenic
1083162739 11:60865209-60865231 CTGGGAAAGCTTGGTGGGGCGGG - Intergenic
1083233721 11:61339052-61339074 CTATGAAACCTGGAGGTGGAAGG - Exonic
1083310413 11:61780904-61780926 CTGGGAGAGCTTGAGGGGAGAGG - Intronic
1083730335 11:64649266-64649288 ATGGGAAACTTTGGGAGGGAGGG - Intronic
1084540324 11:69782365-69782387 CTGGGAGACCCTGAGGAGGAGGG - Intergenic
1084743929 11:71155672-71155694 CTGGGGAGCTTTGAGGGGTATGG - Intronic
1085250697 11:75141744-75141766 CTTGGAAAGCTTGAGGTGGGAGG + Intronic
1085472827 11:76769080-76769102 CTGGCAGCCCTTGAGAGGGAAGG - Intergenic
1087191546 11:95259474-95259496 CTGGGAAACTCTGAAGGGCAAGG + Intergenic
1089777231 11:120846866-120846888 CTGGAAAACCGTGAAGAGGAGGG - Intronic
1090854260 11:130598327-130598349 CTGGGAAACTTGGTGGGGGTCGG + Intergenic
1202811895 11_KI270721v1_random:30636-30658 CTGGGAAACCCTGAGCCAGAGGG + Intergenic
1091917189 12:4278131-4278153 CTGTGAAACATTTAGGGGAAAGG + Intronic
1092226584 12:6752253-6752275 GTGGGAGAGCTTGAGGGGGAGGG + Intronic
1092680042 12:10968834-10968856 CCCTGAAACCTCGAGGGGGAGGG + Intronic
1093734132 12:22600151-22600173 CTGGCTAACATTGATGGGGAAGG - Intergenic
1096686723 12:53292918-53292940 CGTGGAAACCTGGAGGGGGCTGG + Exonic
1097517182 12:60620065-60620087 ATGGAAAACATGGAGGGGGAAGG + Intergenic
1098347915 12:69525022-69525044 CTAGCAAACCTTCAGAGGGAAGG - Intronic
1101439573 12:104693410-104693432 TTGGGACACTTTGAGAGGGAAGG + Intronic
1102586752 12:113928978-113929000 CTTAGAAACATTGAGGGTGAGGG - Intronic
1103550572 12:121734193-121734215 CTGGGAAAACTTGAGTGGCGAGG + Intronic
1103564158 12:121807005-121807027 CTGGGAAACCCTGCCTGGGAGGG + Intronic
1104301814 12:127571275-127571297 CTGGTAACCCTTGAGGAAGACGG + Intergenic
1104958760 12:132478341-132478363 GTGGGATACCTCGAGGGGGGTGG - Intergenic
1104958771 12:132478372-132478394 GTGGGATACCTCGAGGGGGGCGG - Intergenic
1104958782 12:132478403-132478425 GTGGGATACCTCGAGGGGGGCGG - Intergenic
1109813811 13:67551904-67551926 CTGGGCCTCCTTGAGGGTGAAGG + Intergenic
1112508121 13:99987724-99987746 CTGGGAGAGCTGGAGGGGGGAGG - Intergenic
1113094181 13:106646349-106646371 AAGGGAAATCTTGATGGGGAAGG - Intergenic
1113791283 13:113029712-113029734 CTGGGAGACCAAGAGAGGGAGGG + Intronic
1114136013 14:19851903-19851925 ATGGGAAACCATGAGGAGAAAGG - Intergenic
1115805471 14:37046216-37046238 CTGGGAAAGCTTGAGAGCGTCGG - Intronic
1118612252 14:67550607-67550629 CTAGGAAAACGTGAGGGGAAGGG + Intronic
1119064643 14:71512977-71512999 GTGGGACAACTTGAGGGGGTTGG - Intronic
1119172374 14:72544998-72545020 CCATGAAACCTTGAGGAGGAGGG - Intronic
1119187359 14:72652261-72652283 CTGGGAAGCTTTGTGGGGAAGGG - Intronic
1119324716 14:73753039-73753061 CTGGGATACCTTTAAGGGGGAGG + Intronic
1120056240 14:79927448-79927470 CTGGGATGCCTTGAGGAAGAAGG - Intergenic
1121406667 14:93723205-93723227 CTGGGAACCCTGGAGGGGGCTGG - Intronic
1121686417 14:95838603-95838625 CTGGGAGACTGTGACGGGGAGGG - Intergenic
1122379380 14:101290769-101290791 ATGGGAAGCCTTGCCGGGGAGGG - Intergenic
1122418837 14:101563073-101563095 CACCTAAACCTTGAGGGGGAGGG + Exonic
1122804732 14:104250604-104250626 CTGGTAAAGGTGGAGGGGGAGGG + Intergenic
1123003785 14:105311767-105311789 CTGGGAAGCCATGTGGGGGATGG - Exonic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1126472270 15:49026215-49026237 CTGGGAAGGGTTGAGGGAGAGGG + Intronic
1126484281 15:49162141-49162163 CTGGGAAAAGTTAAGGGGGGAGG - Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128148486 15:65346294-65346316 CTGTGAAGCCTTGAGAGGGTGGG + Intronic
1128241781 15:66106179-66106201 ATGGGAAACAATGATGGGGAAGG + Intronic
1129038680 15:72666014-72666036 GTGGGCAACCATGAGGGGCATGG + Exonic
1129211211 15:74071216-74071238 GTGGGCAACCATGAGGGGCATGG - Exonic
1129289307 15:74551515-74551537 CCTGGAAACCTGGAAGGGGATGG - Intronic
1129331968 15:74832416-74832438 CTGCGAAGCACTGAGGGGGAAGG - Intergenic
1129399192 15:75269871-75269893 GTGGGCAACCATGAGGGGCATGG + Exonic
1129402799 15:75294147-75294169 GTGGGCAACCATGAGGGGCATGG + Exonic
1129654733 15:77516623-77516645 CTGGGGACTCTTGAGGGGGATGG - Intergenic
1129728344 15:77915490-77915512 GTGGGCAACCATGAGGGGCATGG - Intergenic
1130867904 15:87947928-87947950 CTTTGAACCTTTGAGGGGGAAGG + Intronic
1132353722 15:101156298-101156320 CTTGGACACCTGGAGGGGGCTGG + Intergenic
1132973059 16:2698300-2698322 CGGGGAGACCCTGAGGTGGATGG + Intronic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1133875850 16:9733638-9733660 CTGGAAAACACTGAGGGTGATGG - Intergenic
1134020535 16:10918414-10918436 CGGGGACACAGTGAGGGGGAGGG - Intronic
1135040236 16:19112765-19112787 CTGTGTAACCTTGTGGGGGAGGG + Intergenic
1135734412 16:24919275-24919297 CTGGGACATCTTGGGGGAGAGGG - Intergenic
1136030167 16:27496940-27496962 CAGGGAAACCTTGAGAGTAAAGG + Intronic
1137548763 16:49422283-49422305 CTGGGAAGCCCTGACAGGGAGGG + Intergenic
1137930926 16:52586900-52586922 CTGGGTTCCCTTGAGGGAGATGG - Intergenic
1138149665 16:54644544-54644566 CTGGGAAGCCGGGAGGGAGAGGG - Intergenic
1138265013 16:55654324-55654346 AAGGGAAACCTAGAGGGGTATGG - Intergenic
1139668244 16:68473196-68473218 CTGTGAAAACTTGAGGGCAAAGG + Intergenic
1139953095 16:70681340-70681362 CTGGGAAACCCCGAGGGGACAGG - Intronic
1140034222 16:71360295-71360317 CTGAGAAAGCTAGAGGGGTAGGG + Intronic
1140785584 16:78338296-78338318 CTGGGAATCCATGAGGGTGTTGG - Intronic
1141450342 16:84095642-84095664 CTGGGCAACCTGGCGCGGGATGG + Exonic
1142641925 17:1289353-1289375 ATGGGGAACCTGGTGGGGGATGG - Intronic
1143566943 17:7727899-7727921 CTGGGAAGCCTTGATGGTGGAGG + Intronic
1143774424 17:9188628-9188650 CTGGGAACCTTTGGAGGGGATGG + Intronic
1143895273 17:10131113-10131135 CTGGGTAACCTGGAGGGGTCAGG - Intronic
1143998416 17:11029880-11029902 CTGCCAAACATTGATGGGGATGG - Intergenic
1144057779 17:11557820-11557842 CTGGATGACATTGAGGGGGAGGG - Exonic
1144784556 17:17824394-17824416 TTGTGAGGCCTTGAGGGGGAGGG - Intronic
1145005862 17:19337386-19337408 CTGGGAGACCCTGATGGGAAGGG + Intergenic
1146140817 17:30366546-30366568 CTGGGAAATCCTAAGTGGGAGGG - Intergenic
1146568659 17:33934842-33934864 GCTGGAAAGCTTGAGGGGGAGGG - Intronic
1147138925 17:38450924-38450946 CTGGTCAAACTAGAGGGGGATGG + Intronic
1148794850 17:50192015-50192037 CAGGAACACCCTGAGGGGGAGGG + Exonic
1148980574 17:51570903-51570925 CTGGGAAACATTGAGAGGCAAGG - Intergenic
1150225222 17:63521006-63521028 TAGGGAAAACTTGAGGGGAAAGG + Intronic
1152288238 17:79424605-79424627 CTTGGAAGCCTGGTGGGGGAGGG - Intronic
1152327270 17:79648743-79648765 CTGGGAAACCTTGATGGCGTGGG - Intergenic
1152526189 17:80889513-80889535 CTGGGGAGCCCTCAGGGGGAAGG + Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152915182 17:83030894-83030916 CTGGGAACCCTGAAGGGCGAAGG + Intronic
1154510178 18:15091000-15091022 CAGGGACACCTTAAGGGAGAAGG - Intergenic
1155162990 18:23210629-23210651 CTGGGAAACCTTGAACAGTATGG - Intronic
1156484261 18:37455005-37455027 CTGGGCATCCCTGAGGGAGAAGG - Intronic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1156842307 18:41623639-41623661 CTGAGAAACCTTGAGCTGTAAGG - Intergenic
1157287200 18:46385012-46385034 CTGGAAATCTTTGAGGGGGAGGG - Intronic
1157555341 18:48609884-48609906 CTGGGTGACCTTGAGGGTGTGGG + Intronic
1157692890 18:49698291-49698313 CTGGGAATGCTTCAGAGGGAGGG - Intergenic
1158114789 18:53983226-53983248 CTGGGAAGGCTGGTGGGGGATGG + Intergenic
1160387235 18:78504018-78504040 CTGGGAAACATAGAGGGGATGGG - Intergenic
1160790948 19:923483-923505 CTGGGAAACCTTCAGAGCTAGGG + Intergenic
1160913695 19:1487066-1487088 CTGGGAAACCAGGAGGGGCGGGG + Intronic
1160970154 19:1764423-1764445 CGGGGAAAGCTGGAGGGAGAGGG + Intronic
1162249564 19:9430811-9430833 CTGGGAAAGCCTGAGGGATAAGG + Intronic
1162959279 19:14116929-14116951 CTGGGAAATGTTCAGGGGGCAGG + Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1162994556 19:14325910-14325932 CTGGACAACCTTGATGGGCAGGG - Intergenic
1163432017 19:17273912-17273934 CTGGGAGACATTGAGGGCGTTGG - Exonic
1163502919 19:17687083-17687105 CTGGGAGACCTTGGGCGGCAGGG - Intronic
1164928031 19:32145799-32145821 CTGGTAAACCTTACTGGGGAAGG - Intergenic
1165549556 19:36572676-36572698 CTGGGAAGACGTGAAGGGGAGGG - Intronic
1165690112 19:37856366-37856388 TTTGGGAACTTTGAGGGGGAGGG - Intergenic
1165866505 19:38942743-38942765 GTGGGAGACCTGCAGGGGGAAGG + Exonic
1168137144 19:54359518-54359540 CTGGGACACCCGGAGAGGGACGG - Intronic
1168160932 19:54509567-54509589 CTGGGACACCCGGAGAGGGACGG + Intronic
925083275 2:1086987-1087009 CTGGGAAACATGGAGGGAAATGG + Intronic
927881990 2:26695440-26695462 CTGGGAGGCTTTGAGGAGGAGGG - Intronic
927979388 2:27364664-27364686 CTGTGAAGACTTGAGAGGGAGGG - Intronic
928118198 2:28563272-28563294 GTGGGAAACCATGATGGGAAGGG - Intronic
929197365 2:39199226-39199248 CTAGAAAACCTAGAGGAGGATGG + Intronic
929429743 2:41877239-41877261 CTGGGACCCCTTGAGGAGGTGGG - Intergenic
929575662 2:43050270-43050292 CTGGGAACCCTTGGGGGCCAGGG - Intergenic
931427088 2:62181069-62181091 CTGGAAACCCCTGAGAGGGAAGG - Intergenic
932417135 2:71580260-71580282 CTGGGAAACCTCCAGAGGGTTGG + Intronic
932951725 2:76301755-76301777 CATGGAAAACTTGATGGGGATGG - Intergenic
933759619 2:85664766-85664788 CTGGGAAAGGCTGAGGGGGCAGG + Intronic
934556310 2:95288819-95288841 CTCGGAAGCCCTGTGGGGGATGG - Intronic
934685081 2:96315274-96315296 GTGGGCAACCTTGAGGGATAAGG + Intergenic
934737599 2:96697837-96697859 CTGGGAAGCCTCAAGTGGGAAGG + Intergenic
935351601 2:102155670-102155692 CTGGGAAACAGTCAGGGGGGTGG - Intronic
935416704 2:102826782-102826804 CTGGGAAAACTTGAGGGAGCGGG + Intronic
935681742 2:105644295-105644317 CTGGGAAACCATAACTGGGACGG - Intergenic
937539140 2:122926693-122926715 CTGGGGATCCTGGAGGGAGAGGG + Intergenic
938391808 2:130912573-130912595 CTGGGAAACCATGCCTGGGAGGG + Intronic
938404784 2:131025402-131025424 CTGGGAAACCCTCAGGGATATGG - Intronic
938406608 2:131036441-131036463 CTGGAAGACCTTGGGGAGGAGGG - Intronic
938505400 2:131875438-131875460 CAGGGACACCTTAAGGGAGAAGG - Intergenic
942320284 2:174730349-174730371 CTGGGAAACCCGGAGGGGAGGGG + Intergenic
942501642 2:176597138-176597160 CTGGGAAACTTTTAGAGGGATGG - Intergenic
943496646 2:188629160-188629182 CTGGGAAAATCTGAGAGGGAAGG + Intergenic
944000087 2:194823652-194823674 CTGCTAAAGCTTGATGGGGAGGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946254941 2:218435448-218435470 CTTGGTAACCTGGAGGCGGAGGG - Intronic
946371168 2:219282126-219282148 CTGGGAGGCCCTGAGGTGGAAGG + Intronic
947819398 2:233059833-233059855 CAGAGCAAACTTGAGGGGGAGGG - Intergenic
948186793 2:236027540-236027562 CTGGGACACCTGGAGGGGAGAGG - Intronic
948876736 2:240833365-240833387 CTGGGAAGCCTGGAAGGGCAGGG + Intergenic
1171138554 20:22720538-22720560 CTGGGACCCCTTGAGGGTGGAGG - Intergenic
1171249663 20:23638158-23638180 CAGGGAAGCCTGGAGGGGCAGGG - Intronic
1172138154 20:32702026-32702048 CTGGGAAACGGTGGTGGGGAGGG + Intergenic
1173821821 20:46024575-46024597 CTGGGAAAGGTTGGGGGAGATGG + Intronic
1173843814 20:46175620-46175642 CTGGGGAATCTTGCAGGGGAAGG - Intronic
1173853917 20:46237600-46237622 CTGGGAACCAAGGAGGGGGAAGG - Intronic
1174761648 20:53212529-53212551 CTGGGACACATCGAGGGGGAGGG + Intronic
1175238012 20:57526398-57526420 CTGGGAGACCTTGGGGGGAATGG + Intergenic
1175238070 20:57526561-57526583 CTGGGAGACCTGGAGGGGAAAGG + Intergenic
1175272879 20:57747162-57747184 CTGGCAGACCTTGAGGGGAAGGG - Intergenic
1176787693 21:13278432-13278454 CAGGGACACCTTAAGGGAGAAGG + Intergenic
1177986858 21:27986887-27986909 CAGGGACACCTTAAGGGAGAAGG + Intergenic
1179433051 21:41338245-41338267 GTCGGAAAACCTGAGGGGGAAGG - Intronic
1179949311 21:44700704-44700726 CTGGGATGCCTTTAGGTGGAAGG - Intronic
1180109355 21:45640917-45640939 CTGGGACATCTGGAGGGGTAGGG - Intergenic
1181464401 22:23102982-23103004 CTGGTAAGCCTTGAGGGAGGAGG + Intronic
1183278917 22:36921983-36922005 CTGGGACACGTGGAAGGGGAGGG + Intronic
1183364548 22:37400092-37400114 CTAGGAAACCGGGAGGGGCAAGG + Intronic
1183752872 22:39732080-39732102 CTGTGAGACCTGCAGGGGGATGG - Intergenic
1184057391 22:42061508-42061530 CTGGAAAACCTTCTGGAGGATGG - Intronic
1184156264 22:42669538-42669560 CTGGGATACCTTGACTGGGCTGG + Intergenic
950296614 3:11837861-11837883 TTGGAGAATCTTGAGGGGGAGGG + Intronic
950936450 3:16844075-16844097 CTGGGATACCTTGGTGAGGACGG + Intronic
951103716 3:18719117-18719139 CTGGGAAAGCCTGTGGGGTAGGG - Intergenic
954273442 3:49527052-49527074 CTGGGAAGCCTTGAGAAGGCAGG + Intronic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956178084 3:66493085-66493107 TTGGAAAACCTTGAGGGAGGAGG - Intronic
956990221 3:74754000-74754022 GTGGGAAACCTGGAGGGTCAAGG + Intergenic
960588795 3:119345677-119345699 CTGGGAAGCCTTTATGGAGAGGG + Intronic
961110830 3:124281680-124281702 CAGGGACAATTTGAGGGGGATGG - Intronic
962819506 3:139034513-139034535 AGGGGAAACTGTGAGGGGGAGGG - Intronic
966759826 3:183407979-183408001 CTGTGAAACCCTGAGGGCTAGGG + Intronic
966793163 3:183691624-183691646 CTAGGAAAGCTTGAGAAGGATGG - Intergenic
966831688 3:184015891-184015913 TAGGGAACCCTTGAAGGGGAAGG - Intronic
969329822 4:6467882-6467904 CAGGGAAACCTTGTGGTGGCTGG - Intronic
970008565 4:11433526-11433548 CTGGAATACCTTCAGGGCGATGG + Intergenic
970803162 4:20000813-20000835 CTGGGAAAGCATCAAGGGGAAGG + Intergenic
971250967 4:24973135-24973157 GTGGGACAACTTGAAGGGGAGGG - Intronic
974640821 4:64627908-64627930 CTTGAAAAGATTGAGGGGGAGGG - Intergenic
976556117 4:86453173-86453195 CTGGGAAAGCTGCAGGGAGAAGG + Intronic
980457569 4:133065520-133065542 CCGGGAAATCTGGAGAGGGATGG + Intergenic
981594965 4:146409498-146409520 CAGGGAAACTTTGGGGGTGATGG + Intronic
981835998 4:149054184-149054206 CTGACCAACCTGGAGGGGGAAGG - Intergenic
983104263 4:163666411-163666433 CTGGGAACTTTTGAGGGGGTTGG - Intronic
984698082 4:182799409-182799431 CGGGATCACCTTGAGGGGGAGGG + Intronic
984868453 4:184306062-184306084 CTGGGAAATTTTGGGGGTGATGG + Intergenic
986717926 5:10537624-10537646 CTGGGATGCCTTGTGGGGCATGG - Intergenic
986782958 5:11084086-11084108 CTAGGAAGCCTTGAGGGGGTAGG + Intronic
989210434 5:38853926-38853948 CTGTGGAGCCTTGAGGAGGAAGG + Intronic
992028088 5:72691264-72691286 CTGAGAAACATTGAGTAGGAAGG + Intergenic
992377168 5:76199427-76199449 CTGGGAAGCTGTGAGTGGGAGGG - Intronic
994688519 5:102987382-102987404 CTGGGAAAGATTCAGGGGAATGG + Intronic
998131822 5:139655283-139655305 ATGGGGAACCCTGAGGCGGAGGG - Intronic
998514056 5:142736998-142737020 CTGGGAAACCTGGAGGGTGGAGG - Intergenic
998747740 5:145280200-145280222 CGGGGAAAATTTGAGGGGGTGGG + Intergenic
998989805 5:147803066-147803088 CTGGGAAGCTCTGAAGGGGATGG - Intergenic
999143432 5:149377720-149377742 CTGGGAAACTTTTCTGGGGAAGG + Intronic
1001038648 5:168316126-168316148 CTGAGAAACGCTGAGGGGGAAGG - Intronic
1002100515 5:176855394-176855416 CTGGGAACCATTGGTGGGGATGG + Intronic
1002591914 5:180296253-180296275 CTGGGAAATCTGGTGGGGGTGGG - Intergenic
1003283050 6:4710776-4710798 CTGGGAAGCTTTGAGGAGGAGGG - Intronic
1003498705 6:6686947-6686969 ATGGGAGGCCTGGAGGGGGATGG - Intergenic
1003789378 6:9526160-9526182 CTGGGACACGATGTGGGGGATGG - Intergenic
1004208401 6:13614184-13614206 CTGTGAACCCCTGAGGGGAAGGG - Exonic
1005830059 6:29663478-29663500 CTGGGAAACCCTAAGGGCAAAGG - Intronic
1005842402 6:29752397-29752419 CTGGGAGACTTGGTGGGGGATGG - Intergenic
1006309933 6:33250234-33250256 CTGAAAAACCTTCAGGAGGAAGG + Intergenic
1007264944 6:40588891-40588913 CTGGAAAGCCTGGTGGGGGAGGG + Intergenic
1008070228 6:47092018-47092040 CTGTGAAACTTTGACTGGGATGG - Intergenic
1008970474 6:57361566-57361588 CTGGGGTACCTTGGTGGGGAAGG - Intronic
1009159443 6:60263387-60263409 CTGGGGTACCTTGGTGGGGAAGG - Intergenic
1009996977 6:70906776-70906798 CTGAGAAACCCAGAGGTGGAAGG - Intronic
1010023688 6:71190781-71190803 CTGGGTAACTTTGAGAGTGAAGG - Intergenic
1011726717 6:90216939-90216961 TTGGGAAATCCTGACGGGGAGGG + Intronic
1012147217 6:95700187-95700209 GTGGGAAACCTTGAGGAGTAAGG - Intergenic
1015865420 6:137722136-137722158 CTGGGACACTGTGAGGGTGATGG + Intergenic
1017438807 6:154443238-154443260 CAGGGAAGCCTTGCAGGGGAGGG - Intronic
1019338100 7:494570-494592 GGGGGAATCCGTGAGGGGGATGG + Intergenic
1019338125 7:494631-494653 CGGGGGATCCGTGAGGGGGATGG + Intergenic
1021596109 7:22318703-22318725 CTGGGAAGCATTGAGGAAGATGG - Intronic
1024516254 7:50261149-50261171 CTGGTAAATCTTTAGAGGGAAGG + Intergenic
1024797540 7:53036516-53036538 CTGGGTGACCTCGAGGGCGAAGG - Exonic
1025010014 7:55388963-55388985 TAGGGAAACCTGGAGGGGGCTGG + Intronic
1029716355 7:102329347-102329369 GTGGGAAAACGAGAGGGGGAAGG + Intergenic
1029722987 7:102382554-102382576 GTGGGAAAACGAGAGGGGGAAGG + Intronic
1030614754 7:111728280-111728302 CTGAGAGACCTTGCGGGGCAGGG + Exonic
1031145556 7:117993840-117993862 TTTCAAAACCTTGAGGGGGATGG + Intergenic
1032497285 7:132371887-132371909 CTGGGGAAACTTGATTGGGAAGG + Intronic
1033012395 7:137636376-137636398 CTGGGAAACATAGAAGAGGAAGG - Intronic
1033238679 7:139658998-139659020 CTGGGAACCCTAGTTGGGGAAGG + Intronic
1034533402 7:151711964-151711986 CTGGGAAACCCAGAGGAGGGCGG - Intronic
1035203473 7:157280512-157280534 CTGGGCAGCCTTGAGGGACAGGG - Intergenic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1035914784 8:3607256-3607278 CTGGGAAGTCTTCAGGGGCAAGG + Intronic
1037888301 8:22606813-22606835 GTGGGAAATCTTGATGGGAAAGG + Intronic
1039514544 8:38120956-38120978 ATGGGTAGCCATGAGGGGGAAGG - Exonic
1044621554 8:94195592-94195614 ATGGGAAGCCTTAAGGAGGAAGG - Intronic
1045648335 8:104320885-104320907 CTGGGGAACTTTGTGGGTGAGGG - Intergenic
1045953961 8:107885227-107885249 CTGGGGAACCTTGTGAAGGATGG + Intergenic
1046387248 8:113520646-113520668 AAGGGCAACCTAGAGGGGGATGG - Intergenic
1047586111 8:126274987-126275009 CAGAGAAACCATGTGGGGGAAGG + Intergenic
1050203335 9:3172357-3172379 ATGAGAAACCTTGAGAGGAAGGG - Intergenic
1050356707 9:4790906-4790928 CTGGAAAACATAGAGGGGGTGGG + Intergenic
1051725941 9:20088512-20088534 CTGGAAAACCCTGGTGGGGATGG - Intergenic
1056636828 9:88338231-88338253 CTGGTAAACCTGGAAGGGTAGGG + Intergenic
1060027784 9:120187573-120187595 CTGGGAATCCTGGAGGAGCAGGG - Intergenic
1060252419 9:121997044-121997066 CTCAGAAAACTTGAGGGGCAAGG + Intronic
1061817882 9:133207219-133207241 ATGGGAAAGCTTGTGGGTGAGGG - Exonic
1062242515 9:135547966-135547988 ATGGGAAAGCTTGTGGGTGAGGG + Exonic
1187345813 X:18462635-18462657 CTGGGGAACCGTTAGGGTGAAGG + Intronic
1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG + Intronic
1190064456 X:47230373-47230395 CTAGGAAACCATGAAGAGGAGGG + Intergenic
1190125855 X:47704859-47704881 ATGGGAAACATTGAGGTGGATGG + Intergenic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1191175653 X:57498471-57498493 CTGGGAACTCGTGGGGGGGAAGG - Intergenic
1194901688 X:99520058-99520080 TTGGTAGACCTTGAGGGGCATGG + Intergenic
1195522551 X:105848300-105848322 CTGGGAAACCTTGAGTGAGTGGG - Intronic
1195696870 X:107673995-107674017 ATGGGAAACCTTCAGAGGAAGGG + Intergenic
1196575607 X:117314813-117314835 CTGGGACTACTTGAGGGGGGAGG - Intergenic
1199228475 X:145407716-145407738 ATGAAAAACTTTGAGGGGGAGGG + Intergenic
1199606322 X:149582498-149582520 CTGGGAAGCGTTGAGTGTGATGG - Exonic
1199615039 X:149649440-149649462 ATGGGAAACCCTGAGTGTGATGG - Intergenic
1199632800 X:149786870-149786892 CTGGGAAGCGTTGAGTGTGATGG + Exonic
1199643658 X:149884944-149884966 CTGGGAAGCGTTGAGTGTGATGG + Exonic
1199980680 X:152918785-152918807 CTGGGTAACCTTTCTGGGGAAGG + Intronic
1200243145 X:154508183-154508205 CTGGGAGATCTTGAATGGGAGGG + Intronic
1201172820 Y:11285744-11285766 CTGGGAACCGTTGTGGGGGGGGG + Intergenic