ID: 1189532285

View in Genome Browser
Species Human (GRCh38)
Location X:41898188-41898210
Sequence AAAATACAGCCTATCAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189532285_1189532287 18 Left 1189532285 X:41898188-41898210 CCAGTCTTGATAGGCTGTATTTT 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1189532287 X:41898229-41898251 TTCTAGGCTATCAAATTTGTTGG 0: 2
1: 16
2: 182
3: 587
4: 1395
1189532285_1189532286 2 Left 1189532285 X:41898188-41898210 CCAGTCTTGATAGGCTGTATTTT 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1189532286 X:41898213-41898235 GTAATTTGTCAATTTCTTCTAGG 0: 1
1: 5
2: 128
3: 945
4: 2321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189532285 Original CRISPR AAAATACAGCCTATCAAGAC TGG (reversed) Intronic
900886920 1:5421748-5421770 AAAGTGCAGCCTTTGAAGACTGG - Intergenic
901950117 1:12738379-12738401 AAAATACAACTTACCAAAACTGG + Intergenic
905134218 1:35785934-35785956 AAAATACAACCTAAGAAGAGAGG + Intergenic
906625965 1:47325941-47325963 AAAAAACAACCTCCCAAGACTGG - Intergenic
907599540 1:55753249-55753271 AAAATACAGAATATCAAGACTGG - Intergenic
907813257 1:57893530-57893552 AGCATACAGTCTATCAAGAAAGG + Intronic
914394359 1:147250759-147250781 AAATGGCAGCCTAGCAAGACAGG - Intronic
915678642 1:157556696-157556718 AATATACAACATATCAAAACTGG - Intergenic
916276217 1:162996721-162996743 AATATATAGCCTTTTAAGACTGG - Intergenic
916361580 1:163976031-163976053 AAAATGCAAACTATCAAAACAGG - Intergenic
918103990 1:181400747-181400769 AAAACACAGGCCATCAGGACTGG - Intergenic
919044947 1:192439494-192439516 GAAGTACAGCCCATCATGACTGG + Intergenic
919131595 1:193457795-193457817 AAAATGCAGCCGACCAAGACAGG - Intergenic
923368639 1:233288335-233288357 AAAATACAGCCAATCACTAATGG + Intronic
1063583259 10:7328852-7328874 AACTTGCAGCCTCTCAAGACTGG + Intronic
1064504514 10:16014339-16014361 ACACTACATCCTCTCAAGACAGG + Intergenic
1065273367 10:24059894-24059916 AACATACAGCTTACCAAGACTGG - Intronic
1066541670 10:36453742-36453764 CAAATTCAGCCTAGCAACACAGG - Intergenic
1068448108 10:57149789-57149811 CAAATACAACCTATCAAGATTGG + Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070007052 10:72434917-72434939 AAAAATCAGCATATCAAGCCTGG - Intronic
1070078437 10:73161476-73161498 GAAACACAACCTGTCAAGACTGG + Intronic
1071253907 10:83849730-83849752 AAGATACAGCCCAGCATGACTGG + Intergenic
1072159911 10:92756550-92756572 AAAACAAAGCCTATCTAAACAGG + Intergenic
1073575790 10:104622192-104622214 AAGAGGCAGCCTAACAAGACAGG + Intergenic
1073734454 10:106329794-106329816 AAAATGTAGCTTAACAAGACGGG - Intergenic
1076101602 10:127784702-127784724 AAAATCCAGCCTATCACTGCTGG - Intergenic
1079227551 11:18620589-18620611 AAAATACATACTATTAAGCCGGG + Intronic
1079953555 11:26834345-26834367 AATATACAGCCTTTCTAGATTGG + Intergenic
1080939230 11:36896582-36896604 AGAAAACAGCCTCTCAAGAAAGG - Intergenic
1080948405 11:37000705-37000727 AATATACAGCCTAGCCAGAGTGG + Intergenic
1085697420 11:78716856-78716878 AAAATACAGACAAGCAACACTGG - Intronic
1085860604 11:80230040-80230062 GATATACAGCCTAACAAGAGAGG + Intergenic
1086456726 11:86966624-86966646 AGGATACAACCTAGCAAGACAGG - Intergenic
1087092465 11:94287986-94288008 AAAATACACACAATCAAAACAGG + Intergenic
1087685850 11:101264321-101264343 AAAATACAGCTTAATAATACAGG + Intergenic
1088386322 11:109260872-109260894 AACATACAACCTTCCAAGACTGG - Intergenic
1088434894 11:109801519-109801541 AAAATACAACCTAGAAAGCCTGG + Intergenic
1088786882 11:113190285-113190307 AAATTACAGCGTGTGAAGACAGG + Intronic
1089117105 11:116104346-116104368 ACAAAACAGCCTATCACAACAGG - Intergenic
1091269414 11:134295788-134295810 AAAACACAGCCCATCAAAATTGG - Intronic
1091307650 11:134547912-134547934 AAAATACAACTTATCAAAATTGG + Intergenic
1092190337 12:6514969-6514991 AAGAAACAGCCTTTCAACACTGG - Intronic
1093188081 12:16044793-16044815 CAAAGACAGCATATCAAAACAGG - Intergenic
1093891920 12:24532068-24532090 AAAATACAGCTTGTTAAAACAGG + Intergenic
1094110845 12:26861220-26861242 AATATGTAGCCTATTAAGACTGG + Intergenic
1095530374 12:43180226-43180248 AAAATGCATCCTATCAAATCAGG + Intergenic
1097427444 12:59464525-59464547 AAAGTATAGCCTAGCAAAACGGG + Intergenic
1099270570 12:80503975-80503997 AAAATACAGAATATCAAAAAAGG - Intronic
1099529041 12:83752853-83752875 ACAATACAGCAAATCAAGAAGGG - Intergenic
1100017269 12:90025730-90025752 AAAATCCAGCCTAACAAGTAAGG + Intergenic
1105414872 13:20202134-20202156 AAAATACAACTTATCAAAATGGG + Intergenic
1106143437 13:27030951-27030973 AAAATACAGCATATCAAAATGGG + Intergenic
1107970688 13:45639722-45639744 AAACTCCAACCTAGCAAGACAGG - Intergenic
1108753171 13:53469618-53469640 AAAATACACCCTTACAAGTCCGG + Intergenic
1110017821 13:70430518-70430540 AAGAGACAGACTATCAAGACAGG + Intergenic
1111539017 13:89647197-89647219 AAAATACAACCTATAAAGACTGG + Intergenic
1113188736 13:107719703-107719725 AGAATACAGACTCTCAAGCCTGG - Intronic
1114222863 14:20712589-20712611 AAAATACAGCCTAACAATATTGG + Intergenic
1115638332 14:35312716-35312738 AAAATACAGGTTATCACCACAGG - Intronic
1118617055 14:67581110-67581132 ACTAGACAGCCTATCCAGACGGG + Intronic
1118902272 14:69996455-69996477 AGAATACAGCCCAAGAAGACAGG - Intronic
1120951561 14:90046398-90046420 AAAATACAGCCTTCCAAATCAGG - Intergenic
1124045586 15:26147086-26147108 AAGGGACAGCCTAGCAAGACAGG + Intergenic
1126260211 15:46680641-46680663 AAAATTCAACTTATCAAAACTGG + Intergenic
1127674060 15:61223928-61223950 AACATACAGCCTAAAAAGATGGG + Intronic
1128387233 15:67158483-67158505 AAAATACTGCCAAGCCAGACTGG + Intronic
1128967695 15:72076842-72076864 AAACTACAGTAAATCAAGACTGG + Intronic
1129638028 15:77343398-77343420 AAAAGACAACCTATGAAGAATGG - Intronic
1131613356 15:93988089-93988111 AGAATAAAGGCTGTCAAGACGGG + Intergenic
1132334847 15:101041035-101041057 AAAATAAAGCCTGTCAGAACTGG - Intronic
1132620666 16:866733-866755 AAAGAGCAGCCTAGCAAGACAGG - Intronic
1133792310 16:9018478-9018500 TAAATACAGCATATCCAGGCCGG + Intergenic
1136006396 16:27332845-27332867 AAAATATAGCCTATCAAAATCGG - Intronic
1137362741 16:47834298-47834320 CAAAGCCAGCCTATAAAGACTGG + Intergenic
1137579597 16:49625689-49625711 AAAATTCAGCCTCTCTAGAAGGG - Intronic
1139189888 16:64850114-64850136 AATATATAGCCTTTTAAGACTGG - Intergenic
1139642861 16:68305420-68305442 ATAATACAGCCTGTCAGCACTGG - Intronic
1140852741 16:78950162-78950184 AATCTACAACCTATCAAGAAGGG - Intronic
1142562930 17:821769-821791 AAAAAACAGCCATCCAAGACAGG + Intronic
1148706819 17:49641406-49641428 AAAATAAACTCTACCAAGACAGG + Intronic
1151167767 17:72219728-72219750 AAAAAAAAGCCAATCAAGGCGGG + Intergenic
1151916075 17:77119011-77119033 AAAATACAGCCTGTACAGGCCGG + Intronic
1152986727 18:328117-328139 AACCTACAGCCTACCAAGACTGG - Intronic
1152987347 18:332781-332803 AAGATATTGCCTATCAAGCCTGG - Intronic
1154179844 18:12125747-12125769 AAAACAAAGCATGTCAAGACTGG + Exonic
1154513527 18:15135678-15135700 TAAATACAGCCATTCCAGACGGG + Intergenic
1155820870 18:30374068-30374090 GAAATACAAGCTATCAGGACTGG - Intergenic
1157038200 18:44003212-44003234 CACATACAACCTACCAAGACTGG + Intergenic
1158843899 18:61420343-61420365 AAAAAAAAGCCTGTGAAGACAGG - Intronic
1160312370 18:77807661-77807683 AAAAGCCAGCCTAGCAAGAGAGG - Intergenic
1163058540 19:14741075-14741097 AAAAAACAGCCTATTCAGCCTGG - Intronic
1163247257 19:16104362-16104384 AAAATAAAGACTAAAAAGACTGG + Intergenic
1163934038 19:20425102-20425124 AAGATGCAGCCTTTCCAGACAGG + Intergenic
1166993858 19:46709852-46709874 AAAATCCATCCTATCAGGAAGGG - Intronic
1167191075 19:47990245-47990267 AAAATACAGGCTAACGAGCCCGG + Intronic
925009811 2:474856-474878 AAAATACAACATATCAAAATTGG + Intergenic
927407658 2:22790234-22790256 AATATAGAGCCAAACAAGACAGG - Intergenic
928577056 2:32666011-32666033 AAAATCCAGACTTTCTAGACTGG + Intronic
929521182 2:42652390-42652412 AAAAGACAGCCTTTCAGGGCTGG + Intronic
930409860 2:51011745-51011767 AAAATACAGATTCTCAAGAATGG - Intronic
931567898 2:63635146-63635168 AACATACAAACTACCAAGACTGG + Intronic
932285387 2:70527333-70527355 AATATACAGCCTTTTCAGACTGG - Intronic
932541490 2:72659049-72659071 AAAAGACAGACTATAAATACTGG - Intronic
934889439 2:98054000-98054022 AAGATTCAACCTATTAAGACTGG + Intergenic
935902078 2:107803751-107803773 AAAAAAGAGTCTATCAAGCCTGG - Intergenic
936054511 2:109251680-109251702 AAAATAGAACCTATGAAGAGAGG - Intronic
936256227 2:110916077-110916099 AAAATACAGGGTAACAAAACAGG - Intronic
936905505 2:117531636-117531658 AAAAAACTGCCTATCAAGCCAGG + Intergenic
937756773 2:125548906-125548928 AATATACAGCCTCTCAAGGATGG + Intergenic
938057196 2:128224968-128224990 AAAATACAACATATCAAAATTGG - Intergenic
939292486 2:140214093-140214115 AAAATACAGCCTATAGAGTTTGG + Intergenic
939608555 2:144282217-144282239 AAAATACAGCTTCTCAGGCCAGG - Intronic
940630077 2:156227411-156227433 AGAATACAGTATATCAAAACTGG + Intergenic
943107414 2:183562959-183562981 AAAATGCAGCATATGAAGACAGG + Intergenic
943542071 2:189228584-189228606 AACATATAGCCTATCAGAACTGG + Intergenic
943557388 2:189422047-189422069 CAAATTCAGTCTATGAAGACTGG + Intergenic
944097699 2:195987883-195987905 AAAATACATCCTAATAAAACTGG + Intronic
944286193 2:197952557-197952579 AAAATACTGCTTACCAAGAATGG - Intronic
946017439 2:216615280-216615302 AAAATACAGGCTATGAGGAGTGG - Intergenic
946700777 2:222411092-222411114 AAAATCCAGCCCATGGAGACTGG - Intergenic
947196981 2:227578023-227578045 AAAATAAAGCCTATGTTGACAGG - Intergenic
1169810066 20:9600909-9600931 AAAACACAGGCTATGCAGACAGG - Intronic
1170525990 20:17238408-17238430 AAATTACAGCCTTTCAGAACAGG + Intronic
1172380069 20:34482425-34482447 TAAATACAGCCATTCAAGATGGG + Intronic
1174901283 20:54503849-54503871 AAACTGCAGCCTATGAAGATGGG + Intronic
1174906561 20:54557914-54557936 AAAATACGGTCTACAAAGACAGG + Intronic
1175055274 20:56192150-56192172 AAACTCCAGCCTATCAACTCAGG + Intergenic
1175658047 20:60789144-60789166 AAATTAAACCCTATGAAGACAGG - Intergenic
1182142774 22:27976362-27976384 AAAATACAACATATCAAAACAGG - Intergenic
1183819591 22:40334649-40334671 AAAATACATCCTACCAAATCAGG + Exonic
1184284116 22:43458063-43458085 ACAGTACAGCCTATCACTACAGG - Intronic
1184860560 22:47171231-47171253 AAAACGCAGCCCAGCAAGACTGG - Intronic
949650286 3:6150079-6150101 TAAATAAAACTTATCAAGACAGG - Intergenic
952223331 3:31347330-31347352 AAAATACATGCTATCTAGATTGG - Intergenic
952513272 3:34078177-34078199 AATATACAGCATTTCAAAACAGG - Intergenic
952749598 3:36814594-36814616 AAAATACATCTCATCTAGACGGG + Intergenic
953189656 3:40672414-40672436 AAAATAGTGACTATCAAGACTGG + Intergenic
954863308 3:53708204-53708226 AAAACACAGTCTTTCAAAACAGG - Intronic
955785966 3:62539264-62539286 AAATTACAGCCTATAACGGCAGG - Intronic
957662914 3:83184240-83184262 TAAATACAGCCAATCAATATGGG - Intergenic
958013486 3:87911469-87911491 AATAAATAGCCTATCAGGACTGG + Intergenic
960301048 3:116002900-116002922 AAAATCCATCATTTCAAGACTGG + Intronic
962859244 3:139382724-139382746 TAAATACAGTCTAGGAAGACTGG + Intronic
965637260 3:170795364-170795386 AATATACAGCCTTTTCAGACTGG + Intronic
975914287 4:79305072-79305094 AGAATTCAGCCCATGAAGACAGG - Intronic
978320510 4:107489095-107489117 AATATACAACTTATCAAGACTGG + Intergenic
979173164 4:117626706-117626728 TAAATACAGCCTTTCCAGCCGGG - Intergenic
982790867 4:159589924-159589946 ATAATAGAGCCTATCTAGAAAGG + Intergenic
983242154 4:165246001-165246023 AATGTAAAGCCTTTCAAGACAGG - Intronic
986772324 5:10985541-10985563 AAAATGCAGCCTATGAGGGCTGG - Intronic
986790870 5:11158578-11158600 CACATACCGCCTCTCAAGACTGG + Intronic
987309283 5:16667161-16667183 CAATTACAGCCTTTAAAGACTGG + Intronic
987650903 5:20738824-20738846 AAAATTCAGCCTATCTACATTGG - Intergenic
990853103 5:60229623-60229645 AAACTCCATGCTATCAAGACAGG + Intronic
991568301 5:68028380-68028402 AAAAAACAGTCTATCTTGACAGG - Intergenic
992053525 5:72963844-72963866 AAATTACAGCCTATCTGGCCAGG - Intronic
992917713 5:81476216-81476238 ACCATACAGCCTTTCAAGTCAGG + Intronic
993381407 5:87212815-87212837 AAAAAACACCTTATCAACACTGG - Intergenic
995539728 5:113173001-113173023 AAAAATCATCCTATCAAAACAGG - Intronic
996532095 5:124536925-124536947 AAAATACAGACTTCCAAGACTGG - Intergenic
999747968 5:154606731-154606753 AAAAGAGAGCCAAACAAGACAGG + Intergenic
1000617188 5:163439787-163439809 CAAATCCAACCTATCAAGAAGGG - Intronic
1000848327 5:166309232-166309254 AAAATATAGTCTCTGAAGACAGG + Intergenic
1002651049 5:180694564-180694586 AACATACAACTTACCAAGACTGG + Intergenic
1003156462 6:3600606-3600628 AAAATACAACATACCAAGACAGG - Intergenic
1003574738 6:7282391-7282413 AGAAAAAAGCCTCTCAAGACTGG + Exonic
1004221255 6:13748423-13748445 AAAATAGAGTGTATCAGGACTGG + Intergenic
1005139167 6:22607746-22607768 ATAATACAGCCTCTCTTGACAGG + Intergenic
1005796664 6:29370050-29370072 AAAAAACTGCCTATCAAGCCAGG - Intronic
1005836914 6:29717169-29717191 AAAATACAGCTTCACAAGAGAGG + Intergenic
1006832082 6:36974934-36974956 AAAATACAACTCATCAAGCCTGG + Intronic
1006969397 6:38025760-38025782 AACATACAGTCTTTCATGACTGG - Intronic
1007175735 6:39896064-39896086 AGAATATAGCATTTCAAGACAGG + Intronic
1007929745 6:45679391-45679413 CAAACACAGACTATAAAGACTGG + Intergenic
1011894659 6:92210576-92210598 AAAATACAGTTTAACAACACTGG - Intergenic
1014796719 6:125733454-125733476 AAAAGAAAGCCTATGAAGAAAGG + Intergenic
1015053878 6:128875781-128875803 AAAATACAGCCATTCCAAACGGG - Intergenic
1018012688 6:159686033-159686055 AGAAAACTGCCCATCAAGACAGG - Intronic
1020757697 7:12224265-12224287 AAAACACAGCCAATCCAGAAAGG - Exonic
1021284387 7:18761284-18761306 AAATTACAGCCCTTCAACACAGG - Intronic
1022640460 7:32177860-32177882 ATAATAAACCCTACCAAGACAGG + Intronic
1024776539 7:52793497-52793519 GAAATACAGGCAATCAAGAATGG + Intergenic
1028499590 7:91504113-91504135 AACATAAAGCCTGTCAAGAATGG - Intergenic
1030812467 7:113990384-113990406 AAAAAACAGTCTGTAAAGACTGG + Intronic
1032581756 7:133109770-133109792 AAAAGACAGCATATAAAAACGGG + Intergenic
1032830086 7:135614460-135614482 TAAATATAGCCTATCAAGGATGG + Intronic
1036532433 8:9605663-9605685 AAAATACAAACTAAAAAGACTGG - Intronic
1036543616 8:9744511-9744533 CAAATACAACCTAAAAAGACTGG - Intronic
1037311832 8:17564361-17564383 AAAATACAGTCTATAAAGTTTGG + Intronic
1039628059 8:39076485-39076507 AAAATATATCCTATGATGACTGG + Intronic
1039962496 8:42260367-42260389 AAAAAAAAGCCTTTCAAGGCCGG + Intergenic
1041406712 8:57507584-57507606 AAAATACAGCAAATCAACACTGG + Intergenic
1041628811 8:60061765-60061787 CAAATAAAGGTTATCAAGACAGG + Intergenic
1043286320 8:78536124-78536146 AAACAAAACCCTATCAAGACTGG + Intronic
1043567918 8:81569406-81569428 AACATACAGCCTTTCAACACTGG + Intergenic
1046640817 8:116729028-116729050 CAAATACAGGTGATCAAGACGGG + Intronic
1047053523 8:121139149-121139171 TAAATACAGCCAATCCAGATGGG - Intergenic
1047551747 8:125881166-125881188 AACATACAACCTACCAAGACTGG - Intergenic
1048403956 8:134099358-134099380 AAAATACGGACTAAGAAGACTGG - Intergenic
1048815034 8:138324813-138324835 ACAATACACCCTATCCTGACCGG + Intronic
1049579445 8:143404684-143404706 AAAATGCAGCCAACCAAGATTGG - Intergenic
1050756141 9:9005983-9006005 AAAATCCAGGCTATTCAGACAGG - Intronic
1051539875 9:18203707-18203729 AAAATACAGACTATCTGGAAAGG + Intergenic
1053403072 9:37845481-37845503 AAAATACACCTTAGCAAAACTGG + Intronic
1055359350 9:75472922-75472944 AAAACAATGCCTTTCAAGACAGG + Intergenic
1055693009 9:78853847-78853869 AAAATACATGCCATCAAGGCCGG - Intergenic
1056161022 9:83894052-83894074 AAAATAAACCTTATCAAAACTGG + Intronic
1056231855 9:84554597-84554619 AAAACACAGTCTATAAAGAAGGG - Intergenic
1056359110 9:85835212-85835234 AAAATAAACCTTATCAAAACTGG - Intergenic
1059002544 9:110365189-110365211 AAAATACAGCCAAAAAAGCCGGG - Intergenic
1060784403 9:126438752-126438774 AAAATACCGCATATCCAAACAGG - Intronic
1186750998 X:12620911-12620933 AAAGACCAGCCTATAAAGACTGG + Intronic
1189532285 X:41898188-41898210 AAAATACAGCCTATCAAGACTGG - Intronic
1190984902 X:55491387-55491409 AATATACAGCCAAACAAAACTGG + Intergenic
1191262395 X:58339635-58339657 AAAAAACAGTCTCTCAAGAAAGG + Intergenic
1192612423 X:72580738-72580760 GAAATAAAGCCAATCATGACAGG + Exonic
1192921760 X:75714153-75714175 AAAATACAGCTTATTAAAATAGG - Intergenic
1193622144 X:83767264-83767286 AAAATACAACTTATCAAGACTGG - Intergenic
1194723547 X:97368431-97368453 AAAATACAGCCTCACAAATCTGG - Intronic
1195092676 X:101477081-101477103 AAAATACAACTAATCAAAACTGG + Intronic
1195146617 X:102024693-102024715 AACATACAACCTACCAAGACTGG + Intergenic
1196475633 X:116081319-116081341 AACATATAACCTATCAAGATTGG + Intergenic
1201537808 Y:15069888-15069910 GAAAAACAGCTTATCATGACTGG + Intergenic