ID: 1189532621

View in Genome Browser
Species Human (GRCh38)
Location X:41902020-41902042
Sequence GGCCTCCAGACTCACCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 6, 3: 25, 4: 224}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189532621_1189532627 -6 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532627 X:41902037-41902059 GAGGCCAAGTCTGCTGGGGTGGG 0: 1
1: 0
2: 4
3: 23
4: 270
1189532621_1189532633 22 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532633 X:41902065-41902087 AACCTGAGTCCATGGATGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 111
1189532621_1189532630 14 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532630 X:41902057-41902079 GGGTTTGGAACCTGAGTCCATGG 0: 1
1: 0
2: 1
3: 26
4: 242
1189532621_1189532635 27 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532635 X:41902070-41902092 GAGTCCATGGATGGTGGGCCTGG 0: 1
1: 0
2: 5
3: 94
4: 354
1189532621_1189532629 -1 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532629 X:41902042-41902064 CAAGTCTGCTGGGGTGGGTTTGG 0: 1
1: 0
2: 1
3: 17
4: 279
1189532621_1189532632 21 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532632 X:41902064-41902086 GAACCTGAGTCCATGGATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 210
1189532621_1189532625 -10 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532625 X:41902033-41902055 TCTGGAGGCCAAGTCTGCTGGGG 0: 1
1: 0
2: 3
3: 17
4: 261
1189532621_1189532636 28 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532636 X:41902071-41902093 AGTCCATGGATGGTGGGCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 154
1189532621_1189532631 18 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532631 X:41902061-41902083 TTGGAACCTGAGTCCATGGATGG 0: 1
1: 0
2: 1
3: 16
4: 186
1189532621_1189532626 -7 Left 1189532621 X:41902020-41902042 CCGCCAGGGTGAGTCTGGAGGCC 0: 1
1: 1
2: 6
3: 25
4: 224
Right 1189532626 X:41902036-41902058 GGAGGCCAAGTCTGCTGGGGTGG 0: 1
1: 0
2: 3
3: 40
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189532621 Original CRISPR GGCCTCCAGACTCACCCTGG CGG (reversed) Intronic
900356561 1:2267899-2267921 GACCTCCAGCCTCCCACTGGAGG - Intronic
900766910 1:4511979-4512001 ACCCTCCAGCCTCACACTGGAGG - Intergenic
901236695 1:7671059-7671081 GGCCATCACACTCACCTTGGGGG - Intronic
901494423 1:9613142-9613164 GGCCTCAGGACCCTCCCTGGAGG + Exonic
902396687 1:16135745-16135767 GCCCTCCAGCCTCACCTTGGGGG + Exonic
903846934 1:26284331-26284353 GGCCTCCAGGCTGAGCCAGGGGG - Intronic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
907623956 1:56010476-56010498 GGCCTCCAGCCACCCCCTGCTGG + Intergenic
908356617 1:63329463-63329485 GGCCTCCGGGGTCACCCTGGAGG + Intergenic
908356618 1:63329465-63329487 GGCCTCCAGGGTGACCCCGGAGG - Intergenic
911975404 1:104488546-104488568 GGCCTCAGGACTCTGCCTGGTGG - Intergenic
914838880 1:151231286-151231308 GGGCTCCAGATACACTCTGGGGG + Intronic
915067608 1:153239508-153239530 ACCCTGCAGTCTCACCCTGGGGG + Intergenic
915215137 1:154335234-154335256 GGGCTCCAGTCGCCCCCTGGTGG + Intronic
917468701 1:175307570-175307592 GTCCCCCAGCCTCACCCCGGCGG - Intergenic
918007367 1:180554456-180554478 GACCTCCATATTCCCCCTGGTGG - Intergenic
921263880 1:213406469-213406491 GGCCACCAGACTTTCCCTGGAGG + Intergenic
922240842 1:223754794-223754816 GGCCTCCGGGCTCACCGAGGGGG + Intronic
923084977 1:230696371-230696393 GGCTTCCAAGTTCACCCTGGAGG + Intergenic
923462904 1:234222572-234222594 GCCCACCAGACTCACCAAGGCGG - Intronic
923656315 1:235920344-235920366 GGTCTGCAGACTTACCCTGGAGG + Intergenic
1062848449 10:725730-725752 GGGCTCCAGACACACCCTGCTGG - Intergenic
1067901653 10:50247936-50247958 GGCCTACAGCCTCTCCCAGGTGG - Intronic
1069915770 10:71785731-71785753 GCCCTCCAGTCTCACCCTCCTGG - Intronic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1071674253 10:87639794-87639816 GGCCTCCCCACTCACAGTGGTGG - Intergenic
1072617117 10:97057229-97057251 GGCCTCCAAACACACCACGGGGG + Exonic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1074866522 10:117547201-117547223 GGCCTCCAGCCCCACCCTGGTGG + Intronic
1075405848 10:122195248-122195270 CGCCTCCAGCCTGACCCAGGAGG - Intronic
1075713828 10:124544576-124544598 GGCCAACAGTCTCACCCTGCAGG + Intronic
1076716199 10:132365222-132365244 CTCCTCCAGACTCACGCCGGGGG - Intronic
1077217867 11:1402570-1402592 GCCCTCCTGACTCCTCCTGGGGG + Intronic
1078427222 11:11261718-11261740 GGGCCCCAGTCTCACCCTGGAGG + Intergenic
1081730106 11:45365784-45365806 GGCATCCAGACTTTTCCTGGAGG - Intergenic
1083145835 11:60757693-60757715 GGCCTCCAGACTCCTCAAGGGGG - Intronic
1083821038 11:65171492-65171514 GCCCTCCAAACTCACCCAGAAGG - Exonic
1083986780 11:66220814-66220836 GGCCTCCAGACTCTCCTTCCTGG + Intronic
1084020573 11:66414975-66414997 AGCCTCCAGTCTGACCCAGGGGG - Intergenic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084802206 11:71552370-71552392 GGGCTGCAGGCACACCCTGGGGG - Intronic
1086291068 11:85309810-85309832 GGGCACCAGACTCAGCCTGCAGG - Intronic
1088729814 11:112670920-112670942 GGTCTCCAGCCACACCCTGCTGG + Intergenic
1089283578 11:117391458-117391480 GCCATCCAGCCTGACCCTGGAGG - Intronic
1089388010 11:118080464-118080486 CGCTTCCAGCCTGACCCTGGGGG + Intronic
1090799262 11:130160262-130160284 GGCTTCCCGCCTCCCCCTGGCGG - Intronic
1091351021 11:134894116-134894138 GGACTCCAGGCTTACCTTGGGGG - Intergenic
1091380084 12:52219-52241 GGCCTCTGGACCCATCCTGGAGG + Intergenic
1093400314 12:18738403-18738425 GGCCTGCACACTCACCTTGGTGG - Exonic
1094450158 12:30575734-30575756 GGCCTCTGGCTTCACCCTGGAGG + Intergenic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1098362909 12:69672513-69672535 GGCATCCAGACACAAGCTGGTGG - Intronic
1100047365 12:90399068-90399090 GGTCTCCAGATTCCCACTGGAGG - Intergenic
1101418630 12:104530747-104530769 AGCCTCCTGACTCACCTTTGGGG + Intronic
1102447793 12:113016940-113016962 CGCTTCCAGACTCACTCTTGTGG - Intergenic
1102525644 12:113510603-113510625 GGCCACCAGAATCCCACTGGAGG - Intergenic
1103571792 12:121849763-121849785 GGACACCACACACACCCTGGTGG - Exonic
1105430657 13:20334310-20334332 GGTCTCCACACTCACCCCTGTGG + Intergenic
1106578410 13:30997420-30997442 GGCCTCCAGAATGCACCTGGTGG + Intergenic
1111703736 13:91722301-91722323 GCCCTGCAGCCTCAGCCTGGTGG + Intronic
1112556418 13:100472557-100472579 TGCCTCCTGACCCACACTGGTGG - Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1114690129 14:24573795-24573817 GGCCTCCGGAATCCCCCTGTAGG + Exonic
1115157394 14:30356629-30356651 GACCTCCAGAATCACTCCGGAGG - Intergenic
1120933037 14:89867528-89867550 GGGCTGCAGGATCACCCTGGAGG - Intronic
1121342734 14:93115204-93115226 GGCCGCCAGACTCGGCCTGTGGG - Exonic
1121410469 14:93745481-93745503 GGCCCCCAGCCCCAGCCTGGTGG + Intronic
1121417353 14:93788550-93788572 GGCCTCCGTCCTCACCTTGGCGG + Intergenic
1122285454 14:100649082-100649104 GCCCTCCAGACTCACTGGGGTGG - Intergenic
1122354345 14:101114181-101114203 GGCCTCCAGATTCCACCTTGAGG + Intergenic
1123891802 15:24788942-24788964 GTCTTGCAGACTCACCCTGCAGG - Intergenic
1125435912 15:39645443-39645465 GGCCTGTAGCCTCACCCAGGAGG - Intronic
1125532299 15:40421634-40421656 GCCTTGCAGACTCACCCTTGGGG - Intronic
1127842123 15:62840712-62840734 GGGCTCCAGGCTCACCCGGGAGG - Exonic
1128513032 15:68325361-68325383 CACCTGCAGACTCACCCTGAGGG - Intronic
1128978583 15:72170252-72170274 GGCCTCTAGCCCCACCCTTGAGG + Intronic
1129709336 15:77812537-77812559 GCCCTCTAGCCCCACCCTGGCGG + Intronic
1130696982 15:86140651-86140673 GGACTCCAGACCCAGCTTGGGGG + Intergenic
1130852321 15:87806599-87806621 AGTCTCCAGTCTCACCCAGGTGG + Intergenic
1131234560 15:90684511-90684533 GCTCTCCAGGCTCAGCCTGGCGG - Intergenic
1131465879 15:92654723-92654745 TGCCTCCAGAATTACGCTGGAGG - Intronic
1132370569 15:101295082-101295104 CGCCCCCGGACTCACCCCGGAGG + Exonic
1132554881 16:568043-568065 GCCCTCCAGACCCAGCATGGAGG - Exonic
1132704564 16:1237513-1237535 GCCCTCCCGAGTCACCCTGAGGG + Intergenic
1132706949 16:1248912-1248934 GCCCTCCCGAGTCACCCTGAGGG - Intergenic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1134261550 16:12655019-12655041 GGCCTCAGGACTCTCCTTGGAGG - Intergenic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1137441016 16:48498458-48498480 GGCCTCCATTTCCACCCTGGTGG - Intergenic
1138821443 16:60264575-60264597 GCACTCCAGCCTCAGCCTGGGGG + Intergenic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140472813 16:75224698-75224720 GGCCGCCAGAGTCGCCCTGTGGG - Exonic
1141660243 16:85437490-85437512 GGCACCCACACCCACCCTGGGGG + Intergenic
1142270710 16:89088074-89088096 GGCCTCCAGGATGGCCCTGGGGG - Intergenic
1143353511 17:6307209-6307231 GGACTTCAGACTCAGACTGGGGG + Intergenic
1143767393 17:9146591-9146613 GGTCTTTAGACACACCCTGGGGG + Intronic
1144669542 17:17125225-17125247 TGCCTCAACACTGACCCTGGGGG - Intronic
1146481741 17:33210536-33210558 GGCCTCCAGTCTCACCCATATGG - Intronic
1146653533 17:34621840-34621862 GCCCTCCAGACTGACCTGGGAGG - Intronic
1146787264 17:35731506-35731528 CCCCTCCAGACTCTCCCTGCGGG - Intronic
1147637862 17:41974868-41974890 GGCCTCCAGAGGCACCATGGAGG - Exonic
1148446254 17:47739369-47739391 GGCCTCCCGAGTCACCCGAGCGG - Intronic
1148470777 17:47891964-47891986 TGCCTCCAGACACACCAGGGAGG + Intergenic
1148901946 17:50884993-50885015 GGCCACCACACTCACCCAGCAGG + Intergenic
1149565037 17:57635354-57635376 ATCCTCCAGACTCACCCTCATGG - Intronic
1149772371 17:59331908-59331930 GGCCTCCGGACTCCCCCGGCCGG + Intronic
1150276915 17:63904415-63904437 AGCCTCCAGGCTCGCCCTGCTGG - Intergenic
1151242823 17:72771503-72771525 GCCCTCCAGGCTCACCTTGCAGG + Intronic
1151362340 17:73596220-73596242 TGCCTCCCCACTCACCCTGCGGG - Intronic
1151577067 17:74958258-74958280 TGCCTCCAGACTCAGCCAAGAGG + Intronic
1151977494 17:77490814-77490836 GGCGGACACACTCACCCTGGAGG + Exonic
1152823499 17:82449350-82449372 GGCCTCCAGACTGGGCCTGATGG - Intronic
1152900756 17:82939741-82939763 GGCCACCAGACACAGCCTTGTGG - Intronic
1157567434 18:48689088-48689110 GGCCTTCAGACACACCCTGGAGG + Intronic
1157871428 18:51233370-51233392 GGCCTTCAGCCTCAGCCAGGAGG - Intergenic
1160123073 18:76147632-76147654 CTCCTCCATACTCAACCTGGGGG - Intergenic
1160377310 18:78422757-78422779 GGCCTGCGGACTCAGCCTTGTGG + Intergenic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160824704 19:1074257-1074279 TCCCTCCAGACCCACCCTGCTGG - Intronic
1162389445 19:10380495-10380517 CGCGTCCAGACTCACCCTTCCGG + Exonic
1164785132 19:30924446-30924468 GGCCTCCTAACTCTCTCTGGAGG - Intergenic
1165151784 19:33764981-33765003 AGTCTCCAGTCTCACCCAGGTGG + Intronic
1165764621 19:38343044-38343066 GGCCCCCAGTCTCACTCTTGAGG - Intronic
1165816768 19:38647475-38647497 GGCCGCCCGACTCAGCCCGGGGG - Intergenic
1166099095 19:40560424-40560446 GGCTTCCTGCCTCCCCCTGGTGG + Intronic
1166126445 19:40717742-40717764 AGCCTCCAGACTCACCCAGAAGG + Exonic
1166823126 19:45592629-45592651 GGACTCCAGACTGGTCCTGGTGG + Exonic
1167497582 19:49828624-49828646 TACCTCCAGCCTCACCCTGTAGG + Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
927522259 2:23706284-23706306 GGCTTCCTGACTGGCCCTGGAGG + Intronic
929856280 2:45640877-45640899 GGCTTCCACAGTCACCCTGAAGG - Intergenic
932713569 2:74085474-74085496 GACCTCCAGACCCACTCTGGGGG + Intronic
936067429 2:109343102-109343124 AGCCTCCACACCCACCCAGGAGG - Intronic
936498978 2:113051079-113051101 GGCCTCCCGACCTAGCCTGGTGG + Intronic
937325911 2:120989482-120989504 GGCCTACAGGCTAGCCCTGGGGG + Exonic
937909006 2:127066361-127066383 TGCCTCCACGCCCACCCTGGGGG - Intronic
938764460 2:134451064-134451086 GGCCTGCAGGCTCCCCCTGTTGG - Exonic
939362773 2:141195280-141195302 GGCTTCCAGGCTCACTCTTGTGG - Intronic
944674042 2:202020270-202020292 GGCATCCAGCCTCACCCCAGAGG - Intergenic
945236154 2:207633393-207633415 GGCAGCCAGCCTCACCCTTGAGG - Intergenic
946477198 2:220018419-220018441 TGCCTCCAGACTCCCCCTGTGGG + Intergenic
947641189 2:231708744-231708766 GGCGTCCAGCCTCACCTTGGTGG - Exonic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
948124523 2:235555100-235555122 AGCATCCAGGCTGACCCTGGCGG - Intronic
948922406 2:241071890-241071912 GGCCTCCCCACCCACCTTGGTGG + Intronic
1168813377 20:720680-720702 GGCCTGCAGAGTCACCCTCTAGG + Intergenic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1170570564 20:17629935-17629957 GGCCTCCTCACTCTCCCTGTGGG + Exonic
1171423395 20:25033909-25033931 GGTCTCTAGACCCTCCCTGGAGG - Intronic
1171967906 20:31544220-31544242 GGCCTCTTGACCCAGCCTGGTGG - Intronic
1171988134 20:31675149-31675171 GCCCTCCAGAGTCACCCAAGAGG - Intronic
1173862335 20:46292212-46292234 GCACTCAACACTCACCCTGGGGG - Intronic
1175114560 20:56673064-56673086 GGCATCCTGACTGATCCTGGAGG + Intergenic
1179486205 21:41712342-41712364 GGCATCCAGGCTCACCCAGAGGG + Intergenic
1179723654 21:43329998-43330020 GACCTCCAGCTGCACCCTGGAGG - Intergenic
1179970447 21:44834340-44834362 GACCTCCACACTGACACTGGTGG + Intergenic
1184098039 22:42327167-42327189 AGCCTCCAGACTCAGCCCTGGGG - Intronic
1184522215 22:45001463-45001485 GGCCACCAGGCTCACCCAGGTGG - Intronic
1184644213 22:45887696-45887718 GGCCTTCAGTCACATCCTGGTGG + Intergenic
950414672 3:12862108-12862130 GGGCTCCAGCCTCAGCCTGCTGG + Intronic
951035618 3:17928721-17928743 GGCTTCCAGACTGAGCCAGGTGG - Intronic
953650046 3:44794348-44794370 GACCTCCCTACTCAACCTGGTGG + Exonic
957888032 3:86316080-86316102 GCCCTCCAGTCCCACCATGGTGG - Intergenic
964034729 3:152181978-152182000 GGCCACCATACCAACCCTGGAGG - Intergenic
964683735 3:159370832-159370854 GGCCTTCAGAATCAGACTGGGGG + Intronic
965256799 3:166424166-166424188 GGCCTCCAGCCCTGCCCTGGGGG - Intergenic
968750966 4:2388829-2388851 GGGCTGGAGAGTCACCCTGGTGG + Intronic
968896137 4:3404737-3404759 TGCCTCCAGCCCCACCCTGGTGG - Intronic
969337130 4:6517721-6517743 GGCCTCCAGGCTCAGCATGATGG - Intronic
974383957 4:61180635-61180657 TGCCTCCAGACTCACTCGTGTGG - Intergenic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
976125519 4:81829902-81829924 GGCCTTCAGACTTATGCTGGTGG - Intronic
978843052 4:113237212-113237234 GGCTGCCAGACTCCTCCTGGGGG + Intronic
983010077 4:162536740-162536762 CTCCTCCACACTCACCCTGGAGG - Intergenic
983552425 4:169031536-169031558 GGCCACCACACGCACCCTGGAGG + Intergenic
983552436 4:169031570-169031592 GGCCACCGCACGCACCCTGGAGG + Intergenic
983552447 4:169031604-169031626 GGCCACCGCACGCACCCTGGAGG + Intergenic
985641782 5:1066803-1066825 TGCCTCCAGAGTCTCCCGGGAGG - Intronic
985733938 5:1566389-1566411 GGCCTCCAGACACACACTTTGGG + Intergenic
985880249 5:2633883-2633905 GGCCTGCAGACTCCCGTTGGAGG - Intergenic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
989568506 5:42924475-42924497 GGCCACCGGGCTCAGCCTGGAGG + Intergenic
990370205 5:55110014-55110036 GGCTTCCAGAATCTCCCTGGAGG - Exonic
999135998 5:149319635-149319657 GGGCTCCAGAGTCACTCCGGAGG + Exonic
999354437 5:150911419-150911441 GGTCTGCAGACTCTCCCTGAAGG + Intergenic
1001787445 5:174425893-174425915 AGCCTCCTGCCTCACCCTGCAGG - Intergenic
1001855415 5:175006054-175006076 GTCCTCCAGGCTCATCCAGGTGG - Intergenic
1002301491 5:178259732-178259754 GTACTCCAGGCTCACCCTGGGGG + Exonic
1003857920 6:10294504-10294526 GCACTCCAGCCTCAGCCTGGGGG + Intergenic
1004191749 6:13470282-13470304 GGCCTCCAGCCACAGCCTGCTGG - Intronic
1006434792 6:34020464-34020486 TGCTGCCAGAGTCACCCTGGGGG + Intronic
1006719123 6:36138773-36138795 GGCTCTGAGACTCACCCTGGGGG - Exonic
1006916425 6:37596875-37596897 TGCCTCCATCCTCACACTGGGGG + Intergenic
1017309491 6:152959141-152959163 GGCCTACTGACTTCCCCTGGAGG - Intergenic
1018565498 6:165146952-165146974 GGGCTCCAGTCTCCTCCTGGTGG + Intergenic
1019496907 7:1345057-1345079 GGACACCACACTCATCCTGGGGG + Intergenic
1022505079 7:30904741-30904763 GGACTGCAGACTCATCCTGAGGG + Intergenic
1023863417 7:44228089-44228111 GGCCAGCAGCCTCTCCCTGGAGG - Intronic
1025004203 7:55342643-55342665 AGCCTCCAGACCCTCCCTGGAGG - Intergenic
1025178252 7:56812614-56812636 GGCCTGCAGACGCAGCCGGGAGG + Intergenic
1025179122 7:56816146-56816168 GGCCTGCAGACGCAGCCGGGAGG + Intergenic
1025180945 7:56823699-56823721 GGCCTGCAGACGCAGCCGGGAGG + Intronic
1025690100 7:63749716-63749738 GGCCTGCAGACGCAGCCGGGAGG - Intergenic
1025690546 7:63751539-63751561 GGCCTGCAGACGCAGCCGGGAGG - Intergenic
1025691432 7:63755138-63755160 GGCCTGCAGACGCAGCCGGGAGG - Intergenic
1025692318 7:63758784-63758806 GGCCTGCAGACGCAGCCGGGAGG - Intergenic
1025692764 7:63760607-63760629 GGCCTGCAGACGCAGCCGGGAGG - Intergenic
1025693179 7:63762286-63762308 GGCCTGCAGACGCAGCCGGGAGG - Intergenic
1025693625 7:63764109-63764131 GGCCTGCAGACGCAGCCGGGAGG - Intergenic
1026165306 7:67904054-67904076 GGCCTTCAGCCTCACACTGGGGG - Intergenic
1029260185 7:99296910-99296932 TGCCCTCAGACTCACCCTGCAGG - Intergenic
1032174273 7:129611366-129611388 GACCTCCAGACTGTGCCTGGGGG - Intergenic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1033605862 7:142928243-142928265 GGCCCCCTGACTCATCCTGGTGG - Intronic
1034205012 7:149307703-149307725 ATCCTCCAGCCTCAGCCTGGAGG + Intergenic
1036149515 8:6284583-6284605 GATCACCAGACTCACCCTGAAGG - Intergenic
1036707624 8:11056882-11056904 GGCCTCTAGTCTCACCCTTCAGG + Intronic
1037737862 8:21581447-21581469 CGCTGCCAGGCTCACCCTGGGGG - Intergenic
1037990676 8:23319571-23319593 GGGCTCAAGACTGATCCTGGGGG - Intronic
1038844196 8:31213639-31213661 GGCCTTCAGATTATCCCTGGTGG + Intergenic
1039922805 8:41905163-41905185 GGCCTGCAGACTCACCCTGGTGG - Intergenic
1040322698 8:46326665-46326687 GGCCTCCAGCCCCCACCTGGGGG + Intergenic
1040322914 8:46327526-46327548 GGCCTCTAGCCCCACCTTGGTGG + Intergenic
1042935463 8:74053832-74053854 AGCCACCAGTCTCACCATGGGGG - Intergenic
1044436632 8:92171833-92171855 GGCCTCCTTTCTCACTCTGGTGG + Intergenic
1047526861 8:125641315-125641337 GGCCTCCTGCCTCAGCCTGCAGG - Intergenic
1048007114 8:130428373-130428395 GGCCTAAAGACTCACCCAGAAGG - Intronic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1048906523 8:139094487-139094509 GGCCTCCACATTCAGCCTGCTGG - Intergenic
1049332765 8:142063908-142063930 GGCCTTCAGCCTGACCCTCGTGG - Intergenic
1049488567 8:142879082-142879104 GGGCTCCAGGCTCATCCTGTGGG + Exonic
1049888741 9:47498-47520 GGCCTCTGGACCCATCCTGGAGG + Intergenic
1052766982 9:32651113-32651135 GGCCTCCAGCCACCCCCTGCTGG + Intergenic
1060951980 9:127609812-127609834 GGCATCCAGGCCTACCCTGGGGG + Intergenic
1061780037 9:132989980-132990002 CGCCCCCAGCCTCACGCTGGGGG - Intronic
1062156539 9:135052037-135052059 GGCCTCCAGAAGCAGCCAGGTGG - Intergenic
1062359425 9:136180619-136180641 GGCCTCCTGCCTCCCTCTGGAGG - Intergenic
1062483347 9:136762556-136762578 AGCCTCCAGCCTCACTCTGTCGG + Intronic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1190279771 X:48922086-48922108 GGCCCCCAGACAGACCCTGCTGG + Intronic
1190334338 X:49253269-49253291 GGCCTGTAGACTCACCTTGTAGG - Intronic
1190745070 X:53317656-53317678 GGTCCCCAGGCTCCCCCTGGTGG - Intronic
1191843563 X:65529929-65529951 GGCCTCCAGCCTCATCTTGTGGG + Intronic
1192165705 X:68826547-68826569 CACCTCCTGACCCACCCTGGCGG - Intergenic
1192524249 X:71828174-71828196 GGCCTGCCGAGTCACCATGGTGG - Intergenic
1192874070 X:75210302-75210324 CTCCTCCACCCTCACCCTGGAGG - Intergenic
1195740918 X:108063730-108063752 AGCCTCTAGCGTCACCCTGGGGG + Intronic
1196193452 X:112817149-112817171 GGTCTCCAGACTCCCTCTGTTGG - Intronic