ID: 1189534526

View in Genome Browser
Species Human (GRCh38)
Location X:41923205-41923227
Sequence GAGCGAGGGCGGCCCGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 1, 2: 8, 3: 52, 4: 497}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189534513_1189534526 7 Left 1189534513 X:41923175-41923197 CCCGGCGCGGGCGGCGGGGCCGG 0: 1
1: 1
2: 22
3: 155
4: 916
Right 1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG 0: 1
1: 1
2: 8
3: 52
4: 497
1189534515_1189534526 6 Left 1189534515 X:41923176-41923198 CCGGCGCGGGCGGCGGGGCCGGG 0: 1
1: 4
2: 16
3: 146
4: 900
Right 1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG 0: 1
1: 1
2: 8
3: 52
4: 497
1189534512_1189534526 8 Left 1189534512 X:41923174-41923196 CCCCGGCGCGGGCGGCGGGGCCG 0: 1
1: 0
2: 12
3: 95
4: 638
Right 1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG 0: 1
1: 1
2: 8
3: 52
4: 497
1189534510_1189534526 11 Left 1189534510 X:41923171-41923193 CCGCCCCGGCGCGGGCGGCGGGG 0: 1
1: 0
2: 4
3: 59
4: 444
Right 1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG 0: 1
1: 1
2: 8
3: 52
4: 497
1189534502_1189534526 28 Left 1189534502 X:41923154-41923176 CCTTCCTCTGCAGGCGACCGCCC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG 0: 1
1: 1
2: 8
3: 52
4: 497
1189534504_1189534526 24 Left 1189534504 X:41923158-41923180 CCTCTGCAGGCGACCGCCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG 0: 1
1: 1
2: 8
3: 52
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189534526 Original CRISPR GAGCGAGGGCGGCCCGGGCC CGG Intronic
900180371 1:1308527-1308549 GCGCAAGAGCGGCCGGGGCCGGG + Intronic
900249271 1:1658812-1658834 GAGCGGGGCGGACCCGGGCCCGG - Intronic
900260219 1:1724156-1724178 GAGCGGGGCGGACCCGGGCCCGG - Intronic
900366160 1:2312787-2312809 GAGGGCAGGCGGCCCTGGCCTGG - Intergenic
900393518 1:2443893-2443915 CAGCGAGGGCGGCGGGGGCGGGG - Intronic
900436490 1:2633540-2633562 GAGGGTGGGCAGCCCTGGCCGGG + Intergenic
900594977 1:3476548-3476570 GGACTAGGGCTGCCCGGGCCTGG - Intronic
900626644 1:3611567-3611589 GAGCCAGGGCGGGTCGGGACTGG - Intergenic
900637655 1:3673908-3673930 GAGCAAGGGAGGCACGGGCCCGG - Intronic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901640789 1:10692111-10692133 GAGCGAGGGCCTCCCAGCCCTGG - Intronic
901696545 1:11012297-11012319 CAGCGAGGGCGGGGCGGGGCGGG - Intergenic
901934564 1:12618570-12618592 GCCCGCGGGCGGCCCGGGCAAGG - Intergenic
902044320 1:13513695-13513717 GCCAGAGGGCGGCCCGGGCGGGG + Exonic
903233832 1:21937220-21937242 GCGAGAGAGCGGCGCGGGCCGGG - Exonic
903907539 1:26696958-26696980 GAGCGGCGGCGGCGGGGGCCTGG + Exonic
904041809 1:27589856-27589878 GAGCCAGTGGGGCCAGGGCCAGG + Intronic
904744491 1:32702700-32702722 GAGCGAGGGGCCCGCGGGCCCGG - Exonic
904775126 1:32901536-32901558 GAGGGAGGGCGGCTCGGCGCCGG - Intergenic
905183188 1:36178850-36178872 GGGCGCGGGCGCCGCGGGCCGGG + Intronic
905647123 1:39632764-39632786 GCCCGAGGTCGGCCCAGGCCGGG - Intronic
905717068 1:40161323-40161345 GTGCGCGGGCGGCCGGGGGCAGG + Intergenic
905819637 1:40979663-40979685 GTTGGAGGGCGGGCCGGGCCTGG - Exonic
905996044 1:42381100-42381122 GAGCGAGGCGGGCCCGGGGAGGG + Intronic
907046320 1:51302332-51302354 GAGTGATGGGGGTCCGGGCCGGG - Intronic
907051092 1:51330389-51330411 GGGCGCGGGCGGCGCGGGCTGGG - Intronic
908501207 1:64745199-64745221 CGGCGAGGGGGGCGCGGGCCTGG + Exonic
908605333 1:65792377-65792399 GAGCGCGGGCGGCCGGGGGAGGG + Intergenic
912516635 1:110220455-110220477 GAGGGAGGGCGGCATGGCCCCGG - Intronic
913144509 1:115976474-115976496 GGGCCGGGGCGGGCCGGGCCGGG - Intergenic
914437040 1:147669807-147669829 GTGAGAGGTCGGCCCGGGCTGGG - Intronic
914899701 1:151705191-151705213 GAGCGAGGTGGGGCTGGGCCGGG - Intronic
916694419 1:167221405-167221427 GCGGGCGGGCGGCCGGGGCCGGG + Intronic
920383749 1:205552327-205552349 GAGAGAGGGCTGCCAGGCCCAGG + Intergenic
921355459 1:214281093-214281115 AAGGGAGGGCGGCCCCGCCCGGG - Intronic
921930182 1:220748505-220748527 GAGCGAGGGCGGGCGCGGACCGG - Exonic
923505242 1:234600060-234600082 GAGGGACCGCAGCCCGGGCCCGG - Intergenic
923782950 1:237042270-237042292 GGAGGAGGGCGGCCCGGGCCCGG - Exonic
924172628 1:241357384-241357406 GAGCGCGGGCTGGCCGCGCCGGG - Intergenic
924446623 1:244138654-244138676 GACCGTGGGCTGCCCGGGCCTGG + Intergenic
1062843815 10:689790-689812 GAGCGCGCGCGGGGCGGGCCGGG - Intergenic
1063429654 10:5977527-5977549 GGGCGAGCGCTGCCCAGGCCGGG + Exonic
1063601604 10:7486350-7486372 GAGGAAGGGCTGCCCGGGGCTGG + Intergenic
1063663730 10:8050012-8050034 TAGAGAGGCCGGCCCTGGCCTGG + Intergenic
1063663735 10:8050030-8050052 GGGCGAGGGCGACCTGAGCCAGG - Intergenic
1064337238 10:14454802-14454824 GAGAGATGGCGGCTTGGGCCAGG - Intronic
1065726050 10:28668824-28668846 GCGCACGGGCGGCCCGGGGCGGG + Intergenic
1065883716 10:30059185-30059207 GAGCGCGGGGGTCCCGGGGCGGG - Intronic
1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG + Intronic
1067497824 10:46775114-46775136 CAGGGAGGGCGGCCCGAGCGCGG - Intergenic
1067596825 10:47565300-47565322 CAGGGAGGGCGGCCCGAGCGCGG + Intergenic
1067883578 10:50068026-50068048 GAGAGAGGCCGGCCTGGGCTGGG + Intronic
1068762945 10:60733178-60733200 GCGGGCGGGAGGCCCGGGCCGGG - Intronic
1070570699 10:77637901-77637923 GGGCGAGCGGGGCGCGGGCCGGG - Intronic
1070906566 10:80078614-80078636 GAGGGAGCGCGGGCCGGCCCCGG + Intergenic
1071579283 10:86755820-86755842 GAGCCCGGGCGCGCCGGGCCTGG + Intergenic
1072680086 10:97499577-97499599 GGGCGAGGGCGCCGCTGGCCTGG + Intronic
1072806612 10:98427463-98427485 GGGCTAAGGCGGCCTGGGCCTGG + Intronic
1073121206 10:101123445-101123467 GAGAGAGGCCGCCTCGGGCCGGG + Intronic
1073290099 10:102409207-102409229 GAGCCGGGCCGGCTCGGGCCGGG - Intronic
1074088772 10:110227472-110227494 GAGAGAGGGCGGTCTGGGGCTGG + Intronic
1075438509 10:122461808-122461830 CTGCGAGGGCGGCCGGGCCCGGG + Exonic
1075802305 10:125160795-125160817 GCGCGGGGCGGGCCCGGGCCGGG - Intronic
1075900910 10:126042185-126042207 CAGGGAGCGCGGCCAGGGCCAGG - Intronic
1076035646 10:127196613-127196635 GGGCGGGGGCGGCGCGGGGCCGG + Intronic
1076035651 10:127196624-127196646 GCGCGGGGCCGGGCCGGGCCGGG + Intronic
1076166581 10:128286971-128286993 CAGGGAGGGCGCCCCTGGCCGGG - Intergenic
1076371605 10:129959300-129959322 GGGCGAGGGAGGCCGGGGCCGGG + Intronic
1076677735 10:132156192-132156214 GAGGGAGGGAGGCGGGGGCCTGG - Intronic
1076721944 10:132396781-132396803 GGGGGAGGGGGGCCCGGGACCGG + Intergenic
1076849662 10:133086687-133086709 GAGTCAGGGCGGCCAGGTCCTGG + Intronic
1076863854 10:133157881-133157903 GAGGGAGGGTGGGCAGGGCCTGG + Intergenic
1076873867 10:133206516-133206538 CAGCGAGGCCAGCCCCGGCCTGG - Intronic
1076900416 10:133335132-133335154 GGGCGAGGGCAGCCAGCGCCGGG + Intronic
1077144054 11:1036980-1037002 CAGCGGGGAGGGCCCGGGCCAGG - Intergenic
1077321436 11:1944290-1944312 GAGCCAGGGCTGCCAGGGGCCGG + Intergenic
1077329805 11:1979278-1979300 GCCCGAGGGCAGCCCTGGCCAGG - Intronic
1077371088 11:2181978-2182000 GAGCGAGGGCGTCCCGGAGATGG + Intergenic
1077376943 11:2209570-2209592 GAGCGTGGGCAGCCAGGGCAGGG - Intergenic
1077476740 11:2794069-2794091 GAGCGAGGGATGGCCCGGCCGGG + Intronic
1077485136 11:2835053-2835075 GAGGGAGGGCGGCCCTGTCCTGG + Intronic
1077495418 11:2884626-2884648 AAGCGGGGCCGGGCCGGGCCGGG + Intronic
1077576440 11:3387143-3387165 GAGCCAGGGGGGGCCGGGCGCGG + Intergenic
1078987105 11:16607214-16607236 GGGGGACGGCGGCCCGGCCCTGG + Intronic
1083171178 11:60924755-60924777 GGGCGAGGGGCGGCCGGGCCCGG + Intronic
1083258027 11:61508646-61508668 GAGGGAGGGCGGGGCGGGGCGGG - Intergenic
1083413055 11:62506792-62506814 GACCCAGGGTGGCCCGGGGCAGG + Intronic
1083780972 11:64917147-64917169 AAGCGGAGGCGGCCCAGGCCCGG - Exonic
1083990412 11:66243032-66243054 GTGCGAGGGCAGGCAGGGCCGGG + Intronic
1083997137 11:66278199-66278221 GAGCGAGGGAGCCGCGGGCGAGG + Exonic
1084175618 11:67420843-67420865 GAGTGAGGGCGGCCGGGGCCGGG + Intronic
1085332903 11:75668045-75668067 GAGCGGGCCGGGCCCGGGCCTGG - Exonic
1085519524 11:77129960-77129982 TAGCGGGGCGGGCCCGGGCCCGG + Intronic
1089394818 11:118129697-118129719 GAGCCAGGGCGGCCTGGGCAAGG + Intergenic
1089604900 11:119636111-119636133 GAGCGATGGGGGCCTGGGGCTGG - Intronic
1090616751 11:128522223-128522245 GAGCGGGCGCGGCGCGGGCGAGG - Intronic
1202812783 11_KI270721v1_random:34457-34479 GCCCGAGGGCAGCCCTGGCCAGG - Intergenic
1091460889 12:642925-642947 GCGTGGGGGCGGCCGGGGCCCGG - Intronic
1091558727 12:1594589-1594611 GAGTGCGGGCGGCCCGGGGCTGG - Intronic
1091684231 12:2550204-2550226 GGGTGAGGGTGGCCCTGGCCGGG + Intronic
1091740758 12:2959245-2959267 GGGCGGGGCCGGGCCGGGCCGGG - Intergenic
1092429383 12:8396843-8396865 GAGCGGCGCAGGCCCGGGCCCGG - Intergenic
1092502914 12:9065434-9065456 GAGCAAGGTCGGGCCGAGCCTGG + Intergenic
1093435326 12:19129675-19129697 GCGCGGGGGCGCGCCGGGCCGGG + Intergenic
1093652586 12:21661794-21661816 GAGCGAGGGAGGCCCAGGCATGG - Intronic
1094466103 12:30754997-30755019 GGCCGAGGGCGGAGCGGGCCGGG - Intergenic
1095977472 12:47949617-47949639 GGGCGTGGGAGGCCTGGGCCGGG - Intergenic
1096062913 12:48717013-48717035 GAGCGTTGGCGCCCCGGGTCAGG + Intergenic
1096513672 12:52145193-52145215 GAGAGAGGGCTGGGCGGGCCTGG + Intergenic
1096699347 12:53371834-53371856 GAGCTGGGCCGGGCCGGGCCGGG + Intergenic
1099959098 12:89379763-89379785 GAGCGAGGGCCGCACAGGCCTGG + Intergenic
1102006387 12:109591578-109591600 GTGCAAGGGAGGCCAGGGCCTGG + Intronic
1102151018 12:110689175-110689197 GGGCGGGGGCGGCCCGGGCGGGG - Intronic
1102278331 12:111599321-111599343 GAGGGAGGGGGGCCGGGGCCGGG + Exonic
1102501815 12:113358519-113358541 GGCCGAGGGCGGGCGGGGCCGGG - Intronic
1103688662 12:122752852-122752874 GCGCTCGGGCGGCCCTGGCCGGG + Exonic
1103923005 12:124409257-124409279 GAGGGAGGTGGGCCAGGGCCAGG - Intronic
1103954300 12:124567723-124567745 GAGCCAGAGGGGGCCGGGCCGGG - Intergenic
1103977734 12:124714581-124714603 GAGGGAGGGCGGCCTCAGCCTGG - Intergenic
1104595228 12:130115982-130116004 GAGCAAGGGCGGTGCGGGCTGGG + Intergenic
1105378024 13:19863092-19863114 GAGGGAGGGGCGCCCCGGCCGGG - Intronic
1105405319 13:20128176-20128198 CAGCGGGGCCGGCCAGGGCCCGG + Intergenic
1105512238 13:21060976-21060998 GGGCAGGGGCGGCGCGGGCCGGG - Intronic
1108541687 13:51452333-51452355 GGGGGAGGGCGGCCGGGGCGGGG - Intronic
1108577823 13:51804301-51804323 GAGTGAGGGCGGACCGGCCCTGG + Intergenic
1113082530 13:106534417-106534439 GAGCGCGGGCGGCGTGGTCCGGG - Intronic
1113541813 13:111115269-111115291 GGGCGACGGCGGCCGAGGCCGGG + Exonic
1113574913 13:111388506-111388528 GAGCGAGGCAGGCCCAGGACTGG - Intergenic
1113784843 13:112997024-112997046 AGGCGAGGGCGGCCCGGGGCTGG - Intronic
1113949629 13:114064813-114064835 GAGTGGGGGCCGCCTGGGCCAGG - Intronic
1114267373 14:21080884-21080906 GAGCCAGGGCCTCCCGTGCCTGG - Exonic
1114474249 14:22982563-22982585 GAGCTAGGGGGGCGGGGGCCGGG - Exonic
1116835799 14:49768213-49768235 GGGCGGCGGCGGCGCGGGCCCGG - Exonic
1117602699 14:57391044-57391066 AGGCGAGGGCGGCCCCCGCCGGG - Exonic
1118312513 14:64704373-64704395 GAGCGAGGGAGGGGCGGGCCAGG - Intronic
1119438170 14:74611521-74611543 GAGCCGGCGCGGCCCGGGTCCGG + Exonic
1119438501 14:74612703-74612725 GAGCGGGGGTGGCGCGGGGCGGG + Intergenic
1119602547 14:75986180-75986202 GAGCGAGTGCGACCCCGGCCGGG - Intronic
1122201302 14:100124226-100124248 GAGTGAGGAAGGCCCGGGCCAGG - Intronic
1122359893 14:101152953-101152975 GAGCGAGGACGGCCAGGGTGTGG - Intergenic
1122419337 14:101565202-101565224 GAGCGAGTGCGGCCCGTGCGGGG - Intergenic
1122486789 14:102087238-102087260 GAGGGAAGGTTGCCCGGGCCGGG - Intronic
1122490374 14:102111274-102111296 GAGCAAGGGGGCCCTGGGCCCGG - Intronic
1122666724 14:103334857-103334879 GGGCGGGGGCGGCCCGATCCCGG + Intronic
1122690352 14:103529296-103529318 GGGTGAGGGTGACCCGGGCCGGG + Intronic
1122857584 14:104567290-104567312 GAGCCAGGGCTGCCCTGGCCTGG + Intronic
1122860947 14:104582147-104582169 AAGGGCGGGCGGCACGGGCCAGG + Intronic
1122880743 14:104689526-104689548 GAGCGAGCGCGGGCCGGGGGCGG - Intergenic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1122993307 14:105249004-105249026 GAGTGTGGGCGGCGCGGGCGCGG - Exonic
1123063350 14:105604460-105604482 GATCGGGGCTGGCCCGGGCCAGG - Intergenic
1123087410 14:105723246-105723268 GATCGGGGCTGGCCCGGGCCAGG - Intergenic
1123630743 15:22258206-22258228 GCGCGCGGGCGCCGCGGGCCGGG - Intergenic
1124120390 15:26883567-26883589 GGGCGGGGGCGGGCGGGGCCGGG + Intronic
1124392188 15:29269477-29269499 CGGCGGGGGCGGCCTGGGCCCGG + Exonic
1124453736 15:29822129-29822151 GAGCGAGCGGGGCACGGGCGGGG + Exonic
1124957163 15:34367116-34367138 GAGGGAGGGCACCCCGGCCCTGG + Exonic
1125531493 15:40416381-40416403 GAGTGAGGGAGCCCCGGGACTGG - Intronic
1127293668 15:57591863-57591885 GGGCGGGGCCGGGCCGGGCCGGG - Intergenic
1127922609 15:63504933-63504955 GGGCGAGGGCGAGCCGGGCCCGG + Intronic
1129082329 15:73052217-73052239 GAGCGGGGGCGGGCCGCGCGCGG + Intronic
1129540977 15:76346781-76346803 GAGCCTGCGCGGCTCGGGCCCGG - Intergenic
1129737714 15:77975285-77975307 TGGGGAGGGCGGCCCAGGCCCGG - Intergenic
1130040748 15:80404065-80404087 GTGCGGGGGCAGCCCGGGCTAGG + Intergenic
1130370881 15:83284578-83284600 GACGCGGGGCGGCCCGGGCCCGG - Exonic
1131122416 15:89830784-89830806 GAGCAAGGGCGGGCAGTGCCAGG + Exonic
1132071289 15:98778588-98778610 GAGTGGGGGCAGCCCTGGCCTGG + Intronic
1132498600 16:275123-275145 GGGCGAGGGCGGGACGAGCCGGG + Intronic
1132599325 16:767015-767037 GAGCCAGGGAGTCCCTGGCCAGG + Intronic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132883118 16:2171016-2171038 GGGCGAGGGCGGCCAAGGCTGGG + Intronic
1133024777 16:2983803-2983825 GGGCGCGCGCGGCCCGCGCCTGG - Intergenic
1134567881 16:15266693-15266715 GAGGGCGGGCGTCTCGGGCCGGG - Intergenic
1134734554 16:16489660-16489682 GAGGGCGGGCGTCTCGGGCCGGG + Intergenic
1134863593 16:17584223-17584245 GAGGGAGGGAGGCAGGGGCCAGG + Intergenic
1134932912 16:18222246-18222268 GAGGGCGGGCGTCTCGGGCCGGG - Intergenic
1135429852 16:22374174-22374196 CAGCGGGGGCCTCCCGGGCCAGG + Intronic
1138421718 16:56903357-56903379 GAGCGATGGGGGCAAGGGCCGGG + Intronic
1138429632 16:56960598-56960620 GACCGAGGGTGCCCCTGGCCAGG - Intergenic
1138591263 16:58000768-58000790 GAGCGAGGCCGCCCCCTGCCGGG + Intronic
1139776254 16:69318794-69318816 GAGGGAGGCCGGCCCGGGCCCGG - Intronic
1140223160 16:73058355-73058377 GAGCGCGGGCGGCGGCGGCCGGG + Intronic
1141513507 16:84527575-84527597 CAGCGAGGGGGGGCCGGGGCGGG + Intronic
1141716467 16:85729852-85729874 GAGGGAGGGCGGCCCTGCCAGGG + Intronic
1141830108 16:86505696-86505718 GGGCGAGGAGGGCGCGGGCCCGG + Intergenic
1141972302 16:87492367-87492389 GCGCGCGGGCGCCGCGGGCCGGG + Intergenic
1142120172 16:88383181-88383203 GCGCTGGGGCGGCGCGGGCCGGG + Intergenic
1142156236 16:88533944-88533966 CAGCGAGGGCAGCCAGAGCCCGG + Exonic
1142672093 17:1491957-1491979 GGGGGAGCGCGGCCCTGGCCCGG - Intronic
1142711909 17:1728056-1728078 GAGAGCGGGCTGCCCGGGGCCGG + Exonic
1142712263 17:1730078-1730100 GAGGGAAGGTGGCCAGGGCCGGG + Intronic
1142810693 17:2394233-2394255 GGCCGAGGGCCGCCGGGGCCCGG + Intronic
1142978528 17:3658835-3658857 GAGCCCGGGCGTTCCGGGCCAGG + Intronic
1143323160 17:6080942-6080964 GAGCCAGCGGGGGCCGGGCCGGG - Exonic
1143474738 17:7196140-7196162 GAGCGGCTGAGGCCCGGGCCAGG + Intronic
1143723981 17:8832958-8832980 CAGCGAGGCCAGCCCGAGCCGGG - Exonic
1143780319 17:9225718-9225740 GGGCCAGGGCGGGCCGGGCAGGG + Intronic
1144269025 17:13600506-13600528 GAGCGGGGCGGGCCCGGGCTGGG - Intronic
1144346795 17:14356688-14356710 GAATGAGGGCTGGCCGGGCCCGG + Intergenic
1144847105 17:18225764-18225786 GTGCGGCGGCGGCCCGGGCCCGG + Intronic
1144949929 17:18988654-18988676 GAGCGTAGCCGGCCCTGGCCTGG - Intronic
1145765530 17:27456301-27456323 CAGGGAGGGCGGCGCGGGCGCGG + Intergenic
1145878278 17:28335915-28335937 GAGCGAGCCCGGCCGGGTCCTGG + Intronic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1147150149 17:38509768-38509790 GACGGAGGGCGGCACGGGGCTGG + Intronic
1147168726 17:38606136-38606158 GAGTGAGCGCGCCCCGCGCCCGG - Intergenic
1147285687 17:39401408-39401430 CGGCGGGTGCGGCCCGGGCCGGG + Exonic
1148090263 17:45019100-45019122 CGGCGCGGGCGGCCCGGGCGGGG + Intergenic
1148206768 17:45784360-45784382 GAGCCGGGCCGGGCCGGGCCGGG + Intronic
1148211319 17:45810556-45810578 GAGCCAGGGTGCCCAGGGCCCGG + Intronic
1148262050 17:46192929-46192951 GCGCGACGGCGGCTCCGGCCCGG + Intronic
1149564578 17:57631893-57631915 GAGCGGGGGCAGCCCAGGCCGGG - Intronic
1149993882 17:61397057-61397079 GAGCGGGGACGGCCTGGGCCGGG - Intergenic
1150259166 17:63774278-63774300 GAGCGCGGCGGGACCGGGCCGGG + Exonic
1150408026 17:64919319-64919341 CAGTGGGGGCGGCCGGGGCCGGG + Intronic
1150692550 17:67378210-67378232 GGGCGAGGCCGGGCCGGGCGCGG - Intronic
1150802273 17:68291585-68291607 TGGCGGGGGCGGCCCGGCCCCGG - Intronic
1150802435 17:68292217-68292239 GTGCGCGCGCGCCCCGGGCCGGG - Intronic
1152069803 17:78128839-78128861 GGGCGGGGGCGCCGCGGGCCGGG - Intronic
1152206977 17:78979453-78979475 GAGAGAGGGGTGCCCTGGCCGGG + Intronic
1152558235 17:81065257-81065279 GAGGGAGGGCGGGCCCAGCCTGG + Intronic
1152613950 17:81329484-81329506 GAGGGAGGAGGGTCCGGGCCAGG + Intronic
1152938108 17:83152345-83152367 GAGCAAGGGGAGCCCGGGACGGG + Intergenic
1153688341 18:7567750-7567772 GCGCGAGGGCGGAGGGGGCCGGG - Exonic
1153900463 18:9614098-9614120 GGGCGAGGGCGGCCCCAGGCGGG - Intronic
1154214870 18:12408307-12408329 GAGCGGGGGCGGCCGGGGCGGGG + Intronic
1154214876 18:12408322-12408344 GGGCGGGGGCGGCCGGAGCCGGG + Intronic
1154494631 18:14946397-14946419 GAGGGAGGGTGCCCAGGGCCAGG + Intergenic
1155055329 18:22177175-22177197 GAGCCAGGGCGGGGCCGGCCGGG - Intronic
1155152744 18:23135667-23135689 GAGCGGCGGCGACCCGGGCTGGG - Intronic
1156008595 18:32471017-32471039 GGGCGCTGGCGGCCCCGGCCGGG - Intergenic
1156099604 18:33578316-33578338 GGGCGGGGGCGGCGCCGGCCGGG - Intergenic
1157665959 18:49487131-49487153 CTGCGAGCGCGGCCCGGGCTGGG + Intronic
1158940436 18:62402356-62402378 GAGAGAGGGAGGCCAGGGCATGG + Intergenic
1160453694 18:78980964-78980986 CAGCGGCGGCGGCCTGGGCCTGG + Intronic
1160521747 18:79511902-79511924 AACAGAGGGCGGCACGGGCCTGG + Intronic
1160559680 18:79748395-79748417 GAGGGAGGGCCGCCCCAGCCCGG + Intronic
1160567857 18:79798208-79798230 GGGCGGGGGCGGCTCGGGGCCGG + Intergenic
1160592181 18:79951123-79951145 GAGCGGGGGCGACCGGGGCCCGG + Intronic
1160631216 18:80247437-80247459 AAGCGAGCGCGGGCCGGGGCCGG - Exonic
1160723609 19:608187-608209 GAGGGAGGCGGGCCCCGGCCTGG + Intronic
1160723641 19:608280-608302 GAGGGAGGCAGGCCCGGTCCTGG + Intronic
1160748004 19:720533-720555 GCGAGAGGGGCGCCCGGGCCTGG + Intronic
1160765363 19:805249-805271 GAGCCCCGGCGGCACGGGCCCGG + Intronic
1160788704 19:913062-913084 GAGCGCGGGCGGGCGGGGCGCGG - Intronic
1160807875 19:1000590-1000612 GGGCCAGGGCGGCGCGGGCGCGG - Exonic
1160807883 19:1000605-1000627 GCGCCAGGGCGGCCCGGGCCAGG - Exonic
1160864442 19:1250725-1250747 CTGCGAGGGCGTCCCGGGCCGGG + Intronic
1160909799 19:1469196-1469218 GCGCGGGGGCCGCCTGGGCCTGG + Exonic
1160981056 19:1816845-1816867 GAGGGAGGGAGGCCGGTGCCTGG - Intronic
1160993806 19:1872727-1872749 GAGGGAGCGCGGGCCTGGCCGGG + Intergenic
1161087982 19:2343910-2343932 GAGTGGGGGAGGCACGGGCCGGG + Intronic
1161152664 19:2717817-2717839 GCGGGTGGGCGGCCGGGGCCGGG + Exonic
1161170055 19:2808048-2808070 GAGGGATGGCAGCCGGGGCCTGG + Intronic
1161175630 19:2841015-2841037 GCAAGCGGGCGGCCCGGGCCTGG - Intergenic
1161232172 19:3179803-3179825 GAGCCTCGACGGCCCGGGCCAGG - Exonic
1161343299 19:3754172-3754194 GTGAGGGGGCGGCCGGGGCCGGG - Intronic
1161388141 19:4007794-4007816 GAGCGGTGGCGGCGCCGGCCGGG + Intronic
1161560409 19:4969567-4969589 CAGCGTGGGTGGCCCCGGCCGGG + Intronic
1161802691 19:6424654-6424676 GGGCGGCGGCGGCCCGGGCGGGG + Exonic
1162013213 19:7830379-7830401 CAGGTAGGGCGGCGCGGGCCGGG + Intronic
1162056293 19:8066037-8066059 GGGCGGAGGCGGCCGGGGCCTGG - Exonic
1162079608 19:8210101-8210123 GAGAGAGGTTGGCCGGGGCCTGG + Intronic
1162304482 19:9863417-9863439 GAGGGAGGGAGGCCAGGGCAGGG + Intronic
1162369672 19:10271176-10271198 GAGTGCGGGCAGCGCGGGCCGGG - Exonic
1162395572 19:10416628-10416650 GGGCTGGGGCGACCCGGGCCCGG + Intronic
1162470916 19:10871639-10871661 CAGCGGCGGCGGCCTGGGCCCGG + Exonic
1163282393 19:16325584-16325606 GCGCGAGGGCGCCCCGGGCCCGG + Exonic
1163567136 19:18058522-18058544 GAGGCAGGGCGGGCCCGGCCGGG + Intergenic
1163651746 19:18521860-18521882 GCGCGAGGCCGGCCCGCGTCCGG + Intronic
1163665959 19:18604203-18604225 GAGCCACGCCGGCCCAGGCCAGG - Intronic
1164564670 19:29317218-29317240 GAGCAAGGGAGGCCCAAGCCCGG + Intergenic
1164639120 19:29811924-29811946 GTGCGAGGGCGGGCCGGGGCCGG + Exonic
1165080426 19:33303193-33303215 GAGCGGAGGCGGCCTCGGCCCGG + Intergenic
1165155034 19:33781731-33781753 GAGGGTGGGGGGCCCTGGCCTGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165349384 19:35268087-35268109 GCGCGGGCGCGGGCCGGGCCAGG - Intergenic
1165685669 19:37817642-37817664 GAGAGAGCCCGGCCCGCGCCTGG - Intergenic
1165723168 19:38093888-38093910 GAGACAGGGCAGCCCTGGCCTGG - Intronic
1166338507 19:42122952-42122974 GAGCCTGGGCGGCCCGCCCCAGG - Intronic
1166361687 19:42255166-42255188 GGGCGTGGGCGTCCCGGCCCCGG - Intergenic
1166564471 19:43755136-43755158 GAGGGAGAGCGGCCCGGATCTGG + Intergenic
1166679034 19:44756427-44756449 GAGGGAGGGGGGCTGGGGCCTGG + Intronic
1166843504 19:45712732-45712754 AAGGAAGAGCGGCCCGGGCCAGG - Exonic
1167001061 19:46746089-46746111 GGGTGAGGCCGGGCCGGGCCGGG + Exonic
1167154549 19:47730159-47730181 GTGAGAGGGCGGGCTGGGCCGGG - Intronic
1167517366 19:49930943-49930965 GAGCCAGGGGGGCAGGGGCCGGG - Exonic
1168063866 19:53908678-53908700 GGGAGGGGGCGTCCCGGGCCGGG - Intergenic
1168077726 19:53990492-53990514 GAGGGAGGAAGGCCTGGGCCTGG - Intergenic
1168144856 19:54415388-54415410 GGGGGAGGGAGGCGCGGGCCGGG - Intronic
1168152402 19:54456082-54456104 CAGCGAGGGACGCCCGGGGCTGG + Exonic
1168240656 19:55087278-55087300 GAGCGAGGGCAGCCCGGGCGCGG - Intronic
1168286949 19:55340002-55340024 GAGCCAAGGCGGCGCGGGGCTGG - Intronic
1168293638 19:55368987-55369009 GAGAGAGGAGGGCCTGGGCCTGG + Intronic
1168641461 19:58034287-58034309 GGGGGAGGCGGGCCCGGGCCCGG + Intronic
1168641476 19:58034308-58034330 GGGAGGGGGCGGGCCGGGCCGGG + Intronic
925527048 2:4814291-4814313 GAGCAAGGGGGCCCTGGGCCTGG + Intergenic
925730737 2:6917984-6918006 GGGACAGGGCGCCCCGGGCCAGG + Intronic
926121459 2:10243358-10243380 GAGAGAGATAGGCCCGGGCCAGG + Intergenic
927152033 2:20201782-20201804 TAGGGAGGGCGGCAGGGGCCTGG - Exonic
927772774 2:25878257-25878279 CAGGGAGGGCGGCCGGAGCCCGG - Intronic
931241751 2:60460708-60460730 GAGCTGGGCCTGCCCGGGCCCGG + Exonic
931461962 2:62457270-62457292 GAGCGAGAGCGCAGCGGGCCAGG - Intergenic
931682920 2:64768008-64768030 GAGGGAGAGGGGCGCGGGCCAGG - Intergenic
932316899 2:70790588-70790610 GAGCGCGGGCGGCGCGGCGCGGG + Exonic
932827835 2:74958288-74958310 GTCCGAGGGAGGCCCGGCCCTGG - Intergenic
934503014 2:94873829-94873851 GCACGAGGGCTGCCCGGGACAGG + Intronic
935265102 2:101387173-101387195 GGGCGGGCGCCGCCCGGGCCAGG - Exonic
936093434 2:109515150-109515172 GACCAATGGCGGCCAGGGCCAGG + Intergenic
936126684 2:109794556-109794578 GAGCGACGGCGGCCTCGACCCGG + Intronic
936218009 2:110576912-110576934 GAGCGACGGCGGCCTCGACCCGG - Intronic
936523286 2:113225953-113225975 GAGGGAGGGAGTCCGGGGCCAGG + Intronic
936600404 2:113889909-113889931 GAGCGCTGGGGGCCTGGGCCTGG + Intergenic
940954376 2:159712229-159712251 GGGCGCTGGAGGCCCGGGCCGGG - Intergenic
942023900 2:171894288-171894310 GAGGGAGGGCGGGCGCGGCCGGG - Intronic
942046550 2:172102427-172102449 GAGCGGCGGCGGCGCCGGCCCGG - Exonic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
943639678 2:190344144-190344166 CAGCGAGGCCGCCCCCGGCCGGG + Intronic
945088890 2:206160146-206160168 GAGGGAGGGAGGCCGGGCCCGGG + Intronic
945234989 2:207625358-207625380 GGGGGCGGGCGGCCCCGGCCCGG + Intronic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
947860476 2:233354436-233354458 GGCCGAGGGCGGGCCGGGCCGGG - Intergenic
948213892 2:236214805-236214827 GCGCGTGGGCGGCACGGGCCGGG - Exonic
948425710 2:237885654-237885676 CAGGGAGGGCGGCCTCGGCCTGG - Intronic
1168790300 20:571878-571900 GGGCGAGGGCGGGGCGGGGCTGG - Intergenic
1169214810 20:3786711-3786733 GAGGGCGGGCGGCGCGGGCGCGG + Intergenic
1170578353 20:17681211-17681233 GGACGAGGGCGCCCGGGGCCCGG - Intronic
1170756737 20:19212292-19212314 GCGCGATGGGGGCCGGGGCCGGG - Intergenic
1170889631 20:20367228-20367250 GAGCGCGGGCGGGCTGGGCTGGG - Intergenic
1171491046 20:25517340-25517362 GAGGGAGGGCTGCCCAGGCCTGG - Intronic
1172882520 20:38211266-38211288 GAGAGAGGCAGGCCTGGGCCAGG - Exonic
1173166237 20:40688960-40688982 GAGCGAGGGCGCAGCGGGCCGGG + Exonic
1173210718 20:41029351-41029373 GAGCGCGCGCGGCCGGGGTCTGG - Intronic
1173516238 20:43667253-43667275 GGGCGAGCGCGGCGCGGTCCGGG + Exonic
1173728440 20:45312548-45312570 GAGTGGGTGCGGCCCAGGCCTGG + Intronic
1173734299 20:45348470-45348492 GGGCGGGGGCGGGCCGGGGCGGG - Intergenic
1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG + Intergenic
1174566222 20:51466346-51466368 TAGGGAGGGAGGCCCGGGCCAGG - Intronic
1174870150 20:54174145-54174167 GAGCGAGGGCGTCCGGGCCTGGG + Intergenic
1175421073 20:58834090-58834112 GAGCGAGCGCGCCTCGAGCCCGG - Intergenic
1175466114 20:59192141-59192163 GGGGGAGGGCGGCCCGGGCCCGG + Exonic
1175859706 20:62143634-62143656 GAGCGGCGGCGCCGCGGGCCCGG + Intergenic
1176015542 20:62929346-62929368 GGGCGAGGGCGGGGCGCGCCTGG + Intronic
1176034892 20:63031440-63031462 GAGCTGGAGGGGCCCGGGCCTGG - Intergenic
1176124498 20:63469461-63469483 GAGCGGGGGCAGCAGGGGCCTGG + Intronic
1176207235 20:63895540-63895562 GAGCCGGGCCGGGCCGGGCCGGG + Intronic
1176234752 20:64049102-64049124 GGGCGGGGGGGGCTCGGGCCGGG - Intronic
1176554648 21:8249761-8249783 GAGGGACCGCGGCCCGGCCCGGG - Intergenic
1176573569 21:8432786-8432808 GAGGGACCGCGGCCCGGCCCGGG - Intergenic
1178610355 21:34073908-34073930 GCGCGTGGGCCGGCCGGGCCCGG + Intronic
1179321118 21:40291855-40291877 GAGCAAAGGAGGCCCAGGCCAGG + Intronic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180083056 21:45495249-45495271 GAGCGTGGGCCGGCCGGGCCTGG + Intronic
1180183033 21:46126469-46126491 GAGAGAGGCCGGGCCAGGCCAGG - Intronic
1180285510 22:10741708-10741730 GGGCGAGCGCGCCCCGAGCCGGG - Intergenic
1180871660 22:19150160-19150182 GTGGGCAGGCGGCCCGGGCCGGG + Exonic
1180949345 22:19714280-19714302 GGGCGGGGGCGGCGCGGGTCTGG + Intergenic
1181582254 22:23834853-23834875 GAGCCAGGGCGGCCCAGGGACGG - Exonic
1181952341 22:26563617-26563639 GAGGGAGGGAGGGCCGGGCGTGG - Intronic
1182518172 22:30870704-30870726 GAGCCAGGGAGCCCCGTGCCAGG - Intronic
1182547568 22:31084909-31084931 GAACGGGGGCGTCCCGAGCCGGG + Intronic
1182753084 22:32657416-32657438 AAGTGAGGGTGGCTCGGGCCGGG - Intronic
1183240388 22:36653472-36653494 GACCGGGGGCTGCCCGGGCTGGG + Intronic
1183294085 22:37019635-37019657 GCGCGGGGGCCGCGCGGGCCTGG + Intronic
1183950589 22:41350465-41350487 CAGGGAGGGTGGCTCGGGCCAGG + Intronic
1183958673 22:41397764-41397786 GAGGGAGAGCTGCCCGGGGCAGG - Exonic
1184141852 22:42582105-42582127 GAGCCATGGCGGGCGGGGCCGGG - Intergenic
1184273363 22:43397206-43397228 GAGGGAGGGCGGGCAGGACCAGG - Intergenic
1184472335 22:44702815-44702837 GAGCGAGGCCCGCCAGCGCCCGG + Intronic
1184557444 22:45240937-45240959 GACCGGGGCCGGGCCGGGCCGGG - Intergenic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1184681052 22:46072196-46072218 GGGCGTGGGCGTCCCGGGGCCGG + Intronic
1184796808 22:46737831-46737853 GCGGGAGGGAGGCCGGGGCCAGG - Intronic
1185037916 22:48489418-48489440 GAGCGCGGGCGGCGCGGGCGCGG + Intergenic
1185313805 22:50170407-50170429 GGGGGCGGGCGGGCCGGGCCGGG - Intergenic
1185330017 22:50248334-50248356 GAGGTAGGGCGGGCAGGGCCGGG - Intronic
1185334953 22:50267313-50267335 GGGGGCGGGCGGGCCGGGCCCGG - Intronic
1203251618 22_KI270733v1_random:121837-121859 GAGGGACCGCGGCCCGGCCCGGG - Intergenic
1203259668 22_KI270733v1_random:166919-166941 GAGGGACCGCGGCCCGGCCCGGG - Intergenic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950182595 3:10926146-10926168 GAGGGAGGGGAGCCTGGGCCAGG + Intronic
952816498 3:37452118-37452140 GCGCGAGCGGGTCCCGGGCCGGG - Exonic
952884206 3:38002784-38002806 GAGGGGAGGCGGCCTGGGCCTGG - Intronic
953099231 3:39809402-39809424 GCGCGCGGGCGGCACGCGCCGGG - Intronic
953143376 3:40249910-40249932 GAGCCAGGTGGCCCCGGGCCAGG + Intronic
953389946 3:42528132-42528154 GAGGGAGGTGGGCCAGGGCCAGG - Intronic
953789511 3:45936706-45936728 GAGGGAGGGCTGCAGGGGCCAGG + Intronic
953916348 3:46923345-46923367 GAGCGAGGTTGGCCAGGTCCTGG + Exonic
954256644 3:49411973-49411995 GAGCGAGGGCGGGCGGCGGCGGG + Exonic
954632824 3:52056370-52056392 GAGCGCGGGCGGCCCGGGGCCGG + Exonic
954714162 3:52518876-52518898 GAGCGGGGCAGGCCAGGGCCAGG - Intronic
954799915 3:53181150-53181172 CAGTGAGGGCAGCCTGGGCCAGG - Intronic
955753284 3:62203772-62203794 GAGGGATGCCGGCCCAGGCCTGG + Exonic
960986137 3:123282248-123282270 GAGCCAGGGGGGCCTGGCCCTGG - Intergenic
961067104 3:123884625-123884647 GTGCGAGGGGGGCCCGGGTCTGG - Intergenic
964720416 3:159763952-159763974 GGGCGGGGCCGGGCCGGGCCGGG + Intronic
966390942 3:179451606-179451628 GAGCGCGCGCAGCCCGGGCGGGG + Intergenic
966711914 3:182980406-182980428 GACGGAGGGCGGCCGGGGCGGGG + Intronic
967838080 3:193981113-193981135 GAGGGAGGGAGGCCTGGCCCAGG - Intergenic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
968514881 4:1011792-1011814 GGGCGCGGGCGGCTCGGGCCGGG - Intronic
968551590 4:1226262-1226284 GTGCAGGGGCGGCCCTGGCCAGG - Intronic
968601954 4:1513646-1513668 GAGTGAGGGCTGCCTGAGCCCGG + Intergenic
968601972 4:1513706-1513728 GAGTGAGGGCTGCCTGAGCCGGG + Intergenic
968622689 4:1610860-1610882 GAAAGAGGGCAGCCGGGGCCCGG - Intergenic
968820171 4:2844036-2844058 TAGCGGGGGCGGCGGGGGCCCGG + Intronic
968893505 4:3385220-3385242 AGGCGAGGGCTGCCAGGGCCAGG - Intronic
968910208 4:3473639-3473661 GAGTGACGGGGGCCGGGGCCGGG + Intronic
969239585 4:5889722-5889744 GAGCGAGGGTGGCCTAGGCTTGG + Intronic
969330752 4:6472382-6472404 GGGCGGGGGCGGCCGGGGGCGGG + Intronic
969416990 4:7067531-7067553 CAGCGAGGCCGAGCCGGGCCGGG - Intronic
969574825 4:8030670-8030692 GAGAGAGTGCGCCCCGGGCTGGG - Intronic
969621323 4:8280308-8280330 GAGGGAGGAGGGCCTGGGCCTGG + Intronic
970620343 4:17811198-17811220 GAGAGGCGGCGGCCGGGGCCGGG - Intronic
970620352 4:17811222-17811244 GAGGGAGGGTGGGCCGGGGCGGG - Intronic
972437128 4:39045016-39045038 GAGCGGGGGAGGCGGGGGCCGGG - Intergenic
972543275 4:40057176-40057198 GATCGGAGGCGGCCCGCGCCGGG - Intronic
973802734 4:54495187-54495209 GAGTGAGAGCGGCCCTGGCCAGG + Intergenic
974047151 4:56907962-56907984 GAGCGAGCGCCGCCGAGGCCCGG + Exonic
976146230 4:82044554-82044576 GAGAGCGGGCGGCCGGGGCGGGG + Intergenic
976595667 4:86892540-86892562 GAGCGCGGCCTGCCCCGGCCCGG - Intronic
977908276 4:102501627-102501649 GAGCGCGGCGGGGCCGGGCCAGG - Exonic
979455640 4:120922844-120922866 GGGCGCGGGGGGCGCGGGCCTGG + Exonic
981118182 4:141016755-141016777 GAGCCAAGGCGGCCAGGGACAGG - Intronic
981550279 4:145936613-145936635 GGGCGCGGGCTGCTCGGGCCAGG - Intronic
982184241 4:152779913-152779935 GAGAGAGGCCGTCCAGGGCCAGG + Intronic
984758208 4:183342985-183343007 GAGGGAGGGAGCCCAGGGCCTGG - Intergenic
985521921 5:377758-377780 GCGGGAGGGAGGCCTGGGCCTGG + Intronic
985549563 5:526104-526126 GAGGGAGGGCAGCCCTGGCCTGG + Intergenic
985838069 5:2284869-2284891 GAGCGACCTCGCCCCGGGCCTGG + Intergenic
986286524 5:6363046-6363068 GAGCAAGGGGGTCCTGGGCCTGG + Intergenic
989043047 5:37249056-37249078 GAGCGAGGACGGGCCCGGACTGG + Intronic
989137272 5:38167712-38167734 GAGCCAGGGCGGCCTGTGCTTGG + Intergenic
989209585 5:38846026-38846048 GTGCAGAGGCGGCCCGGGCCGGG - Exonic
990021101 5:51128451-51128473 GAGCAGGGGGGGCCTGGGCCGGG - Intergenic
992088621 5:73299152-73299174 GAGCGCCGGCGGGCCGGGCGGGG - Intergenic
992269905 5:75053468-75053490 GAGCGAGGGTCGCCCGGGGCTGG - Intergenic
993531180 5:89027224-89027246 GAGCAAGGGGGACCTGGGCCTGG + Intergenic
997980403 5:138464848-138464870 GGGCGAGGGCGAGTCGGGCCGGG - Intergenic
998173056 5:139883541-139883563 GACAGAGTGCGGCCCGGGCAGGG + Intronic
998205983 5:140157256-140157278 CAGGGAGGGAGGCCCGGGGCTGG - Intergenic
999113167 5:149139690-149139712 GAGCAAGGGAGTCCAGGGCCTGG + Intergenic
1001065110 5:168529675-168529697 CGGCGGGGGCGGCCGGGGCCGGG + Exonic
1001392154 5:171388027-171388049 GAGCGAGGCCGAGCGGGGCCTGG + Intronic
1001409745 5:171502376-171502398 GATGGAGGGCTGCCCGGACCAGG - Intergenic
1001638439 5:173229124-173229146 GAGCCAGTGCGGCGGGGGCCGGG + Intergenic
1002006622 5:176239076-176239098 GAGGGAGGGAAGCGCGGGCCTGG + Intronic
1002066996 5:176656845-176656867 GAGTGAGGGCGGCCCCGGCAAGG - Intronic
1002211425 5:177601744-177601766 GAGCCAGGGTGGCCTGGGCCTGG + Intronic
1002219756 5:177671560-177671582 GAGGGAGGGAAGCGCGGGCCTGG - Intergenic
1004690236 6:17987308-17987330 GCGAGAGCGCGGCCGGGGCCGGG - Intronic
1006369226 6:33633839-33633861 GGGCGGGGCCGGGCCGGGCCGGG + Intronic
1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG + Intergenic
1007383117 6:41503273-41503295 GAGCGAAGACGGCCGGGGGCAGG + Intergenic
1007625356 6:43243531-43243553 GATCGGGGCCGGGCCGGGCCGGG + Intergenic
1012338756 6:98092069-98092091 GACAGAGGGAGGGCCGGGCCTGG + Intergenic
1014913766 6:127120739-127120761 GAGCGACAGGGGCCCTGGCCGGG + Intronic
1015910230 6:138162024-138162046 AAGCGCGGGCGAGCCGGGCCGGG - Exonic
1017324717 6:153131447-153131469 GCGCGAGGTCGGGCGGGGCCGGG - Intergenic
1017954953 6:159169713-159169735 GAGCGCCGGGGGCCCGGGCGCGG - Intronic
1018432200 6:163731044-163731066 GGGCGAGGGCTGCCCTGGGCTGG + Intergenic
1018447138 6:163868039-163868061 GAGCGAGAGGGGCAGGGGCCTGG + Intergenic
1018613207 6:165662664-165662686 GAGCGCGGCGGGCCCGGGCCCGG - Intronic
1018786998 6:167116307-167116329 GAGCGAGGGCGGGGAGGCCCCGG - Intergenic
1018890509 6:167978254-167978276 CAGCGCGGGCGGCCGGGGCGAGG + Intergenic
1019474286 7:1236566-1236588 GCTCAAGGGCGGCGCGGGCCTGG + Exonic
1019530702 7:1501852-1501874 GAGCGTGTGCTGCCCAGGCCAGG + Intronic
1021717288 7:23471218-23471240 GAGTGGGGGCGGCCCGGCCCCGG + Intergenic
1022400046 7:30028371-30028393 GCGCGAGCGCGTCCCGGGCCCGG + Exonic
1022721105 7:32942666-32942688 GAGCGAGGCCCGCCCGGCCACGG - Intergenic
1023810295 7:43906432-43906454 GGGCGGGGGCGCCCCTGGCCGGG + Intronic
1024424788 7:49212814-49212836 GAGCAAGGGGGCCCTGGGCCTGG + Intergenic
1025850506 7:65239786-65239808 GCGCGAGGGCGGGGCGGGGCGGG + Intergenic
1026899214 7:74027820-74027842 GAGCGAGGGGGGCCTCTGCCAGG - Intronic
1026962532 7:74417797-74417819 GAGAGAGGCCGGCCAGGGCGTGG + Intergenic
1029075080 7:97928500-97928522 GAGCGGCGCAGGCCCGGGCCCGG - Intergenic
1029207758 7:98879271-98879293 GAGCCTGGGGGGCCCTGGCCGGG - Intronic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029414805 7:100436098-100436120 GCGCGAGGCCGTCGCGGGCCGGG + Intronic
1029708315 7:102286783-102286805 GCGCGAGGGGGGGCGGGGCCGGG + Intronic
1029710089 7:102294741-102294763 GAGAGAGGGAGGCCCGGACATGG - Intronic
1029736200 7:102467295-102467317 GAGCTGGGGTGGGCCGGGCCTGG + Intronic
1030211072 7:106996299-106996321 GAGAGAGTGCAGCCAGGGCCAGG - Intergenic
1030216020 7:107044687-107044709 GAGCGAGCGCGGCCCCGGGAGGG - Exonic
1030292150 7:107883490-107883512 GAGTGAGGGCGGGCCGGGCGCGG + Intergenic
1032078313 7:128846507-128846529 GAGCGAGGAGGGCCAGGGGCTGG - Intronic
1032190483 7:129762653-129762675 GGGCGAAGGCGGCCCGGGTGCGG + Intergenic
1034273652 7:149814872-149814894 GAGGGAGGGAGGCCCTGCCCTGG + Intergenic
1034412210 7:150947565-150947587 GGGCGAGGGAGGACCGGGCGTGG - Intronic
1034441408 7:151087578-151087600 AAGCGGGAGCGGGCCGGGCCTGG + Intronic
1034911564 7:155002660-155002682 GGGCGCGGGAGGCCCGGGCCCGG - Intronic
1035169687 7:157010542-157010564 GTGCGAGCGCGGCCCGGGGCGGG - Exonic
1035700015 8:1631282-1631304 GAGCGAGGGCAGCTGGGCCCTGG + Intronic
1035751660 8:2001261-2001283 GAGCGAGGGCGCCGCGTCCCCGG + Exonic
1037305248 8:17497319-17497341 GGGCGAGGGCGCCCTGGGGCCGG + Intronic
1037589975 8:20304005-20304027 GGGCGGGGCCGGCCCGGGGCGGG + Intergenic
1038157155 8:25001114-25001136 GAGCTCGGGAGCCCCGGGCCCGG - Intergenic
1038176343 8:25184719-25184741 GACCGCGGGCGGCGCGGGCACGG + Intronic
1039468016 8:37797430-37797452 GAGCGGCGGCGTCCCTGGCCCGG + Exonic
1040462173 8:47659621-47659643 GAGCGAGGGCGGGGCGGGGTGGG - Intronic
1043463671 8:80485949-80485971 GGGCGTGTGCGGCCGGGGCCGGG - Intronic
1044819261 8:96144944-96144966 GGGCGAGGGCAGCCAAGGCCTGG + Exonic
1044973799 8:97644416-97644438 AAGCGAGGAAGGGCCGGGCCGGG - Exonic
1047961879 8:130016790-130016812 GAGCCGGGGCGCCACGGGCCCGG + Intronic
1047998628 8:130358744-130358766 GAGCGGGGGCGGGGCGGGGCGGG - Intronic
1048980950 8:139703233-139703255 GGGCAGGGGCGGCGCGGGCCCGG + Intergenic
1048981248 8:139704204-139704226 GAGGGAGGGAGGCCCGGCCTCGG - Intergenic
1048985203 8:139731331-139731353 AAGCGAGGGCCGCCCAGGCCTGG + Intronic
1049570867 8:143369727-143369749 GGGCGTGGGCGCCCAGGGCCTGG - Intronic
1049620912 8:143597956-143597978 GGGCGCGGGGGGCCCGGGCAGGG - Exonic
1049651259 8:143771079-143771101 GAGCGGGGGGGCCCCAGGCCTGG - Intergenic
1049769685 8:144374119-144374141 GATCTCGGGCGCCCCGGGCCGGG - Intronic
1049784487 8:144444063-144444085 GTGCGAGGGCGGCCCTGGGGCGG + Intronic
1049792425 8:144478168-144478190 GAGGGAGAGGGGCCCCGGCCAGG + Intronic
1049957493 9:707157-707179 GATCGAGGGCGCCCGAGGCCGGG + Intronic
1053129246 9:35605716-35605738 GAGGAGGGGCGGCCCCGGCCCGG - Exonic
1056773875 9:89497874-89497896 GAGGGAGGGCGCGCGGGGCCGGG - Intronic
1057228844 9:93306629-93306651 GAGAGAGGGCCGACCCGGCCGGG - Intronic
1057439813 9:95074802-95074824 GAGCAGGTGCGGCCTGGGCCTGG - Intronic
1057773099 9:97984233-97984255 GAGCGGGGGAGGGGCGGGCCAGG + Intronic
1058058589 9:100473364-100473386 GAGCGCCGCGGGCCCGGGCCTGG + Exonic
1058058805 9:100474103-100474125 GAGGGAGGGCGGCCCCAGGCAGG + Intronic
1059061447 9:111038374-111038396 GATCTGGGGCGGCCAGGGCCCGG - Intronic
1059208262 9:112486801-112486823 GGGCGCGGGCGGGCCGGGGCGGG - Intronic
1059471149 9:114505506-114505528 GAGGGGGCGGGGCCCGGGCCGGG - Intergenic
1060209014 9:121699201-121699223 GGCCGAGGGCGGGCCGGGCTCGG - Intronic
1060812080 9:126615632-126615654 GAGCGGGCGCGGGCCGGGCCCGG - Intronic
1060945912 9:127569198-127569220 GACCGAGGGCGGGGCGGGGCGGG - Intronic
1061181581 9:129027901-129027923 GAGCCCGTGCGGCCCGAGCCGGG - Intronic
1061584043 9:131554968-131554990 GAGCGCGGGCGGCGTGGGCGCGG - Intergenic
1061781155 9:132996747-132996769 AGGGGAGGGCGGCCCGGCCCTGG + Intergenic
1061843804 9:133375814-133375836 GTCAGGGGGCGGCCCGGGCCTGG + Intronic
1061933805 9:133846565-133846587 GATAGAGAGCGGCCGGGGCCAGG - Intronic
1062022612 9:134326547-134326569 CGGCGCGGCCGGCCCGGGCCCGG - Intronic
1062181355 9:135192882-135192904 GAGGCAGGGCGCCGCGGGCCGGG - Intergenic
1062529868 9:136995132-136995154 GCGGGAGGGCGCCCTGGGCCTGG - Intronic
1203745204 Un_GL000218v1:37532-37554 GAGCTGGGGAGGGCCGGGCCTGG + Intergenic
1203468020 Un_GL000220v1:104988-105010 GAGGGACCGCGGCCCGGCCCGGG - Intergenic
1203475841 Un_GL000220v1:148960-148982 GAGGGACCGCGGCCCGGCCCGGG - Intergenic
1203564904 Un_KI270744v1:81952-81974 GAGCTGGGGAGGGCCGGGCCTGG - Intergenic
1186426126 X:9465292-9465314 GGGCGGGGGCGGCCCGGGGGCGG + Exonic
1189104249 X:38220469-38220491 CCGCGAGGGCGCCCCGCGCCTGG + Intronic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1189821628 X:44874025-44874047 GGGCGAGCGCGGCGCCGGCCAGG - Intronic
1192410484 X:70928977-70928999 CAGCCAGTGTGGCCCGGGCCTGG - Exonic
1193654898 X:84187608-84187630 GAGTGAGTGCAGCCTGGGCCCGG - Intronic
1195285236 X:103376912-103376934 CAGCGAGGGGAGCCCGGGCTCGG + Intronic
1195625261 X:107000071-107000093 GAGCGAGGGAGGGCCGGTCCCGG - Exonic
1196442223 X:115727968-115727990 GAGGGTGGCCGGGCCGGGCCGGG + Intergenic
1196455449 X:115888739-115888761 GAGGGTGGCCGGGCCGGGCCGGG - Intergenic
1200045306 X:153397733-153397755 GAGCTTGGGCGGCCCGGCCCTGG - Intergenic
1200114785 X:153765264-153765286 TAGCGAGTGGGGCCCTGGCCTGG + Intronic
1200211508 X:154348751-154348773 CGGCCAGGGCGGCCTGGGCCGGG + Exonic
1200247199 X:154532518-154532540 GAGGGTGGGCGGCCTGGGCCCGG - Intronic
1200256073 X:154584211-154584233 GGGTGAGGGCGGCACGGCCCCGG - Intergenic
1200261696 X:154620192-154620214 GGGTGAGGGCGGCACGGCCCCGG + Intergenic