ID: 1189536142

View in Genome Browser
Species Human (GRCh38)
Location X:41937127-41937149
Sequence GGCCAACGGGAAGCCCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189536137_1189536142 0 Left 1189536137 X:41937104-41937126 CCCTCTGGCTTCTGGCTGAGTTT No data
Right 1189536142 X:41937127-41937149 GGCCAACGGGAAGCCCCTGTAGG No data
1189536138_1189536142 -1 Left 1189536138 X:41937105-41937127 CCTCTGGCTTCTGGCTGAGTTTG No data
Right 1189536142 X:41937127-41937149 GGCCAACGGGAAGCCCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189536142 Original CRISPR GGCCAACGGGAAGCCCCTGT AGG Intergenic
No off target data available for this crispr