ID: 1189540688

View in Genome Browser
Species Human (GRCh38)
Location X:41984849-41984871
Sequence CAGGCTATAAAACCGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189540688_1189540695 -6 Left 1189540688 X:41984849-41984871 CCTGAAACCGGTTTTATAGCCTG No data
Right 1189540695 X:41984866-41984888 AGCCTGCGTGGGTGGTGGCTGGG No data
1189540688_1189540694 -7 Left 1189540688 X:41984849-41984871 CCTGAAACCGGTTTTATAGCCTG No data
Right 1189540694 X:41984865-41984887 TAGCCTGCGTGGGTGGTGGCTGG No data
1189540688_1189540698 24 Left 1189540688 X:41984849-41984871 CCTGAAACCGGTTTTATAGCCTG No data
Right 1189540698 X:41984896-41984918 TGTTTTAACTGACACAGAGTAGG No data
1189540688_1189540696 -5 Left 1189540688 X:41984849-41984871 CCTGAAACCGGTTTTATAGCCTG No data
Right 1189540696 X:41984867-41984889 GCCTGCGTGGGTGGTGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189540688 Original CRISPR CAGGCTATAAAACCGGTTTC AGG (reversed) Intergenic
No off target data available for this crispr