ID: 1189543868

View in Genome Browser
Species Human (GRCh38)
Location X:42021531-42021553
Sequence CCAAGAAAGGGGAAGGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189543868_1189543879 22 Left 1189543868 X:42021531-42021553 CCAGTTCCCTTCCCCTTTCTTGG No data
Right 1189543879 X:42021576-42021598 TCTTGTCCTGAAGCTATCTAGGG No data
1189543868_1189543878 21 Left 1189543868 X:42021531-42021553 CCAGTTCCCTTCCCCTTTCTTGG No data
Right 1189543878 X:42021575-42021597 CTCTTGTCCTGAAGCTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189543868 Original CRISPR CCAAGAAAGGGGAAGGGAAC TGG (reversed) Intergenic
No off target data available for this crispr