ID: 1189545848

View in Genome Browser
Species Human (GRCh38)
Location X:42042052-42042074
Sequence CTCTATACACACATGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189545843_1189545848 0 Left 1189545843 X:42042029-42042051 CCTGTGTCCTCACATGGCCATTC No data
Right 1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG No data
1189545838_1189545848 28 Left 1189545838 X:42042001-42042023 CCTGGCTTGTAGATGGCCATACC No data
Right 1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG No data
1189545839_1189545848 12 Left 1189545839 X:42042017-42042039 CCATACCTTTTCCCTGTGTCCTC No data
Right 1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG No data
1189545840_1189545848 7 Left 1189545840 X:42042022-42042044 CCTTTTCCCTGTGTCCTCACATG 0: 6
1: 87
2: 547
3: 1508
4: 2936
Right 1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG No data
1189545842_1189545848 1 Left 1189545842 X:42042028-42042050 CCCTGTGTCCTCACATGGCCATT No data
Right 1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG No data
1189545844_1189545848 -7 Left 1189545844 X:42042036-42042058 CCTCACATGGCCATTCCTCTATA No data
Right 1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189545848 Original CRISPR CTCTATACACACATGGAGAG AGG Intergenic
No off target data available for this crispr