ID: 1189546057

View in Genome Browser
Species Human (GRCh38)
Location X:42043724-42043746
Sequence GACCATGTGGCCCAAGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189546053_1189546057 10 Left 1189546053 X:42043691-42043713 CCAATCACAGGAAAACCAATGTC No data
Right 1189546057 X:42043724-42043746 GACCATGTGGCCCAAGTTGTTGG No data
1189546052_1189546057 16 Left 1189546052 X:42043685-42043707 CCAGAGCCAATCACAGGAAAACC No data
Right 1189546057 X:42043724-42043746 GACCATGTGGCCCAAGTTGTTGG No data
1189546055_1189546057 -5 Left 1189546055 X:42043706-42043728 CCAATGTCAAAACAGGCAGACCA No data
Right 1189546057 X:42043724-42043746 GACCATGTGGCCCAAGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189546057 Original CRISPR GACCATGTGGCCCAAGTTGT TGG Intergenic
No off target data available for this crispr