ID: 1189546945

View in Genome Browser
Species Human (GRCh38)
Location X:42051205-42051227
Sequence GTGGGTGTGACATGCGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189546945_1189546953 30 Left 1189546945 X:42051205-42051227 CCATCCACGCATGTCACACCCAC No data
Right 1189546953 X:42051258-42051280 TTCAGTGTCACACCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189546945 Original CRISPR GTGGGTGTGACATGCGTGGA TGG (reversed) Intergenic
No off target data available for this crispr