ID: 1189546953

View in Genome Browser
Species Human (GRCh38)
Location X:42051258-42051280
Sequence TTCAGTGTCACACCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189546948_1189546953 11 Left 1189546948 X:42051224-42051246 CCACTCTTCTTGTTACCAGTCTT No data
Right 1189546953 X:42051258-42051280 TTCAGTGTCACACCCCTGCCAGG No data
1189546946_1189546953 26 Left 1189546946 X:42051209-42051231 CCACGCATGTCACACCCACTCTT No data
Right 1189546953 X:42051258-42051280 TTCAGTGTCACACCCCTGCCAGG No data
1189546947_1189546953 12 Left 1189546947 X:42051223-42051245 CCCACTCTTCTTGTTACCAGTCT No data
Right 1189546953 X:42051258-42051280 TTCAGTGTCACACCCCTGCCAGG No data
1189546945_1189546953 30 Left 1189546945 X:42051205-42051227 CCATCCACGCATGTCACACCCAC No data
Right 1189546953 X:42051258-42051280 TTCAGTGTCACACCCCTGCCAGG No data
1189546949_1189546953 -4 Left 1189546949 X:42051239-42051261 CCAGTCTTTCACCCTCCAATTCA No data
Right 1189546953 X:42051258-42051280 TTCAGTGTCACACCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189546953 Original CRISPR TTCAGTGTCACACCCCTGCC AGG Intergenic
No off target data available for this crispr