ID: 1189550635

View in Genome Browser
Species Human (GRCh38)
Location X:42088897-42088919
Sequence TCTTGCATCCAGACGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189550635_1189550638 6 Left 1189550635 X:42088897-42088919 CCATGCAGCGTCTGGATGCAAGA No data
Right 1189550638 X:42088926-42088948 ACCTCCCCAAATTGTTCCTGGGG No data
1189550635_1189550637 5 Left 1189550635 X:42088897-42088919 CCATGCAGCGTCTGGATGCAAGA No data
Right 1189550637 X:42088925-42088947 AACCTCCCCAAATTGTTCCTGGG 0: 12
1: 128
2: 210
3: 180
4: 238
1189550635_1189550636 4 Left 1189550635 X:42088897-42088919 CCATGCAGCGTCTGGATGCAAGA No data
Right 1189550636 X:42088924-42088946 GAACCTCCCCAAATTGTTCCTGG 0: 9
1: 127
2: 187
3: 179
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189550635 Original CRISPR TCTTGCATCCAGACGCTGCA TGG (reversed) Intergenic
No off target data available for this crispr