ID: 1189556018

View in Genome Browser
Species Human (GRCh38)
Location X:42146209-42146231
Sequence GGCACTGCCATCTTAACAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189556018_1189556021 18 Left 1189556018 X:42146209-42146231 CCACTTGTTAAGATGGCAGTGCC No data
Right 1189556021 X:42146250-42146272 TATCCCCAGCCCCTGAATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189556018 Original CRISPR GGCACTGCCATCTTAACAAG TGG (reversed) Intergenic
No off target data available for this crispr