ID: 1189558160

View in Genome Browser
Species Human (GRCh38)
Location X:42166260-42166282
Sequence GGGGAAACTGCAGTGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189558147_1189558160 17 Left 1189558147 X:42166220-42166242 CCATGCAGGCAAAGCAATGTGGG No data
Right 1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG No data
1189558145_1189558160 21 Left 1189558145 X:42166216-42166238 CCAGCCATGCAGGCAAAGCAATG No data
Right 1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG No data
1189558143_1189558160 27 Left 1189558143 X:42166210-42166232 CCATGCCCAGCCATGCAGGCAAA No data
Right 1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG No data
1189558142_1189558160 30 Left 1189558142 X:42166207-42166229 CCTCCATGCCCAGCCATGCAGGC No data
Right 1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG No data
1189558144_1189558160 22 Left 1189558144 X:42166215-42166237 CCCAGCCATGCAGGCAAAGCAAT No data
Right 1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189558160 Original CRISPR GGGGAAACTGCAGTGGTGGG AGG Intergenic
No off target data available for this crispr