ID: 1189559938

View in Genome Browser
Species Human (GRCh38)
Location X:42182063-42182085
Sequence CAGGGTCAGCGTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189559932_1189559938 1 Left 1189559932 X:42182039-42182061 CCATCACAAAGGAAATGAGGGGC No data
Right 1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG No data
1189559927_1189559938 26 Left 1189559927 X:42182014-42182036 CCAGTCTAGAGTTAAGGATTTCT No data
Right 1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG No data
1189559926_1189559938 27 Left 1189559926 X:42182013-42182035 CCCAGTCTAGAGTTAAGGATTTC No data
Right 1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG No data
1189559925_1189559938 28 Left 1189559925 X:42182012-42182034 CCCCAGTCTAGAGTTAAGGATTT No data
Right 1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189559938 Original CRISPR CAGGGTCAGCGTGAGGAGGA GGG Intergenic
No off target data available for this crispr