ID: 1189561281

View in Genome Browser
Species Human (GRCh38)
Location X:42193829-42193851
Sequence CCTGGCTGCAAATATGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189561281_1189561288 0 Left 1189561281 X:42193829-42193851 CCAGCTGCATATTTGCAGCCAGG No data
Right 1189561288 X:42193852-42193874 CTTGGTGGGAAGCCTCGGCAAGG No data
1189561281_1189561290 20 Left 1189561281 X:42193829-42193851 CCAGCTGCATATTTGCAGCCAGG No data
Right 1189561290 X:42193872-42193894 AGGTGACCAATCCCTCCCACTGG No data
1189561281_1189561287 -5 Left 1189561281 X:42193829-42193851 CCAGCTGCATATTTGCAGCCAGG No data
Right 1189561287 X:42193847-42193869 CCAGGCTTGGTGGGAAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189561281 Original CRISPR CCTGGCTGCAAATATGCAGC TGG (reversed) Intergenic
No off target data available for this crispr