ID: 1189561290

View in Genome Browser
Species Human (GRCh38)
Location X:42193872-42193894
Sequence AGGTGACCAATCCCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189561281_1189561290 20 Left 1189561281 X:42193829-42193851 CCAGCTGCATATTTGCAGCCAGG No data
Right 1189561290 X:42193872-42193894 AGGTGACCAATCCCTCCCACTGG No data
1189561286_1189561290 2 Left 1189561286 X:42193847-42193869 CCAGGCTTGGTGGGAAGCCTCGG No data
Right 1189561290 X:42193872-42193894 AGGTGACCAATCCCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189561290 Original CRISPR AGGTGACCAATCCCTCCCAC TGG Intergenic
No off target data available for this crispr