ID: 1189573123

View in Genome Browser
Species Human (GRCh38)
Location X:42320900-42320922
Sequence GTGGGGCTCAACCTGGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189573121_1189573123 -10 Left 1189573121 X:42320887-42320909 CCATGTGGCTTCTGTGGGGCTCA No data
Right 1189573123 X:42320900-42320922 GTGGGGCTCAACCTGGTTACAGG No data
1189573118_1189573123 -5 Left 1189573118 X:42320882-42320904 CCAGTCCATGTGGCTTCTGTGGG No data
Right 1189573123 X:42320900-42320922 GTGGGGCTCAACCTGGTTACAGG No data
1189573115_1189573123 5 Left 1189573115 X:42320872-42320894 CCAAAGGAAACCAGTCCATGTGG No data
Right 1189573123 X:42320900-42320922 GTGGGGCTCAACCTGGTTACAGG No data
1189573113_1189573123 11 Left 1189573113 X:42320866-42320888 CCTGACCCAAAGGAAACCAGTCC No data
Right 1189573123 X:42320900-42320922 GTGGGGCTCAACCTGGTTACAGG No data
1189573114_1189573123 6 Left 1189573114 X:42320871-42320893 CCCAAAGGAAACCAGTCCATGTG No data
Right 1189573123 X:42320900-42320922 GTGGGGCTCAACCTGGTTACAGG No data
1189573111_1189573123 28 Left 1189573111 X:42320849-42320871 CCAAGGGAGTACTTCTGCCTGAC No data
Right 1189573123 X:42320900-42320922 GTGGGGCTCAACCTGGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189573123 Original CRISPR GTGGGGCTCAACCTGGTTAC AGG Intergenic
No off target data available for this crispr