ID: 1189577000

View in Genome Browser
Species Human (GRCh38)
Location X:42364680-42364702
Sequence CTCAGGACCCCTAGTAATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189577000_1189577004 30 Left 1189577000 X:42364680-42364702 CCACTATTACTAGGGGTCCTGAG No data
Right 1189577004 X:42364733-42364755 TCCAACCTGCAGCCCAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189577000 Original CRISPR CTCAGGACCCCTAGTAATAG TGG (reversed) Intergenic
No off target data available for this crispr