ID: 1189586109

View in Genome Browser
Species Human (GRCh38)
Location X:42463602-42463624
Sequence ACATATCCACAGGTAGTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189586109_1189586114 17 Left 1189586109 X:42463602-42463624 CCTCGGACTACCTGTGGATATGT No data
Right 1189586114 X:42463642-42463664 TGTCTATCTCACTCCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189586109 Original CRISPR ACATATCCACAGGTAGTCCG AGG (reversed) Intergenic
No off target data available for this crispr