ID: 1189586147

View in Genome Browser
Species Human (GRCh38)
Location X:42463916-42463938
Sequence CTGAAAATACATATGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189586143_1189586147 19 Left 1189586143 X:42463874-42463896 CCGGGGCTGCGTGCACTTCCCAA No data
Right 1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG No data
1189586145_1189586147 0 Left 1189586145 X:42463893-42463915 CCAACTCTCTTAAAATAATAGCA No data
Right 1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG No data
1189586144_1189586147 1 Left 1189586144 X:42463892-42463914 CCCAACTCTCTTAAAATAATAGC No data
Right 1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189586147 Original CRISPR CTGAAAATACATATGGAAAC AGG Intergenic
No off target data available for this crispr