ID: 1189586869

View in Genome Browser
Species Human (GRCh38)
Location X:42470766-42470788
Sequence CTGTTGAAGGGGAATCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189586869_1189586878 1 Left 1189586869 X:42470766-42470788 CCACCCAGATTCCCCTTCAACAG No data
Right 1189586878 X:42470790-42470812 GGATGGGTTGTCCCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189586869 Original CRISPR CTGTTGAAGGGGAATCTGGG TGG (reversed) Intergenic
No off target data available for this crispr